Questions about transfering wgs file to reference genome file
Hi, I have a task to transfer cram file to fa file. For example, I have a cram file named as chr_123.cram.
I intend to use samtools to transfer this file to fa file, with reference genome hg38.fa. The out file should be chr_123.fa.
My chr_123.fa should contain chr information, for example:
>chr1
........................
But my current method (samtools) only uses my fa file, and my file does not contain chr information. It contains information like:
>H25LYCCXX150109:3:2222:11535:23653/1
GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGATATCGGAAGAGCACACGTCTGAACTCCGGTTAGGTATGCGTATAGCGTATGGGGTCTTGTGATTGAAAAAGTAAG
Thanks.
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Need help using ExpansionHunter
written by brianhill_nc •
-
Questions about a bug when transferring cram file to bam file
written by me •
-
BAM to CRAM and BAM recover with smaller size
written by geocarvalho
-
Alignments on IGV display not matched to the result from "samtools mpileup"
written by magicRG •
-
Output bedGraph from genomeCoverageBed is missing "chr"
written by m98
-
Is there something wrong with my Indel Calling protocol?
written by lishen0709 •
-
FastaAlternateReferenceMaker creates different size fasta.
written by zaibunnisa.t •
-
awk one line command
written by prasoonagar •
-
Concatenation of Samtools Faidx - 60nt limit by line
written by ryan.leenay •
-
GATK BaseRecalibrator - Input files knownSites and reference have incompatible contigs
written by cl10101 •
What does "transfer" mean? Is this aligned data and you want a consensus sequence? What exactly do you need.
Hi, thanks for your reply. I think it may not be teh consensus sequence. I intend to have an individual genome file, that is, each chr contains individual sequence information.
That is what a consensus sequence is. See https://www.htslib.org/doc/samtools-consensus.html
Thanks a lot. That seem the exact thing I am looking for!