miRNA alignment with Bowtie2
Hi, I was trying to align my microRNAs using Bowtie2 but I get this result:
bowtie2 --local -p 8 -q --phred33 -D 20 -R 3 -N 0 -L 8 -i S,1,0.50 -x miRNA_mature_index -U ../trimmed_reads/trimming_bbduk/H1_trim.fastq.gz -S H1_mature.sam
9637480 reads; of these:
9637480 (100.00%) were unpaired; of these:
9567222 (99.27%) aligned 0 times
1182 (0.01%) aligned exactly 1 time
69076 (0.72%) aligned >1 times
0.73% overall alignment rate
and I used for trimming this command:
bbduk.sh -Xmx2g in="$input_file" out="$output_file" literal=GCGCCGCTGGTGTAGTGGTATCATGCAAGATTCCAACTGTAGGCACCATC ktrim=r k=7 &> "${file_name}.trim.log"
If I set k=15, alignment rate is 0%
Any advices?
• 2,031 views
•
link
0 answers
No answers yet.
Log in to answer this question.
You want ungapped alignments so it may be better to try
bowtie v.1.xas well.What is the size of the sequences left over after you do that trimming? Are they between 20-26 bp? If that is your miRNA adapter then you should choose only those sequences that have that adapter.
Hi, the sequence length after trimming is this:
I'm not able to find a proper trimming for data. However, if I run bowtie v.1.3, results are better:
However I'm afraid from trimming step. if I use cutadapt,
cutadapt -u 4 -m 15 -q 20 -e 0.1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -g ^CAGTCG -g ^TGACTC -g ^GCTAGA -g ^ATCGAT -o H1_R1.fastq.gzthere is 0% alignment rate!You should figure out the exact miRNA adapter used in this dataset by finding which kit was used. Looks for read that contain that adapter. After trimming you should be left with reads that will be small 20-25bp. Those would be ones to use.
Dear GenoMax , I am asking to the guy lab the kit used. However, I will show you the fastq first lines.
It seems that some sequences contain
CACTGAACCGthat is present in the header. They did do demultiplexing. Should I remove also this sequence? Please give me some advice, I'm little confused. With bbduk command, it removes completely the illumina adapters (FASTQC report), but read length are between 10-101 bp.You can try to take a selection of reads and see if you are able to figure out what the adapter could be (programs like
fastpmay be able to do this).Example
thank you so much.
so I tried to inspect my fastq (I highlighted my adapter with **)
But I think there is also that needs to be filtered because the mean length of peaks is 46 bp.
dear genomax, they replied "We have used the QIAseq miRNA UDI Library Kit. The used UDIs you can be found in the report we have provided you in your sFTP folder in Article II." Where I have to add this adapters? 5' end?
Looks like there may be more than one kit version. You should be able to find the manuals from Qiagen's site. Here is one version: https://genome.med.harvard.edu/documents/libraryPrep/QiagensmRNAmiRNAProtocol.pdf On page 57 you can find the adapter sequences. Generally adapters are ligated to 3'-end of miRNA's. But there may be other library specific adapters on 5'-end.
Ok, thank you very much!!! I used the adapted indicated here and by your file and I was able to get a decent number of reads with a peak between 16 and 23 bp. I will go forward with other analysis and I will see if there is a decent alignment rate!