Hi guys,
I have 10 excel files with several columns and rows. The column headers are similar in all file but for the rows some items are similar while others are not. Below is an excerpt for one of the files:
tag id score probability of true positive read count significant mature miRBase miRNA example miRBase miRNA with the same seed consensus mature sequence consensus star sequence consensus precursor sequence precursor coordinate
scf7180000638994_294 40938.9 76 +/- 17% 80293 yes Gmo-Mir-8-5p dps-miR-8 uaauacugucagguaaagauguc caucuuaccgggcagcauuaga caucuuaccgggcagcauuagauuucauugaacuaaauuucuaauacugucagguaaagauguc GmorY1_scf7180000638994:57393..57457:-
scf7180000646270_8382 21683.4 76 +/- 17% 42524 yes Gmo-Mir-1-5p dps-miR-1 uggaauguaaagaaguauggag ccaugcuuccuugcauucaaua ccaugcuuccuugcauucaauaguauuuaaauucgcauauggaauguaaagaaguauggag GmorY1_scf7180000646270:15242..15303:-
scf7180000641396_3727 16329.7 76 +/- 17% 32022 yes Gmo-Mir-276-2-5p dps-miR-276a uaggaacuucauaccgugcucu agcgagguauagaguuccuacg agcgagguauagaguuccuacguuauaauauauuaucuguaggaacuucauaccgugcucu GmorY1_scf7180000641396:101253..101314:+
scf7180000642685_5346 14242.6 76 +/- 17% 27930 yes Gmo-Mir-375-5p dps-miR-375-3p uuuguucguuuggcuuaaguu acuuaagccaagugaauacaaaca acuuaagccaagugaauacaaacauauaaaaauugauuccauacgguuuguucguuuggcuuaaguu GmorY1_scf7180000642685:7898..7965:-
scf7180000648092_10507 6965.5 76 +/- 17% 13654 yes Gmo-Mir-2a-5-5p dps-miR-2a uaucacagccagcuuugaugagcu ccucaucaagugguugugaua ccucaucaagugguugugauauggauuaucaacgcauaucacagccagcuuugaugagcu GmorY1_scf7180000648092:46212..46272:+
scf7180000648092_10505 6279.1 76 +/- 17% 12309 yes Gmo-Mir-2a-3-5p dps-miR-2a uaucacagccagcuuugaugagcu ccucacaaaguggcugugaaaug ccucacaaaguggcugugaaauguugugaauuauaugauuuuaguucuaauucaaucuaaaauugcauaucacagccagcuuugaugagcu GmorY1_scf7180000648092:45974..46065:+
scf7180000652159_25218 5249.2 76 +/- 17% 10289 yes Gmo-let-7-5p dps-let-7 ugagguaguagguuguauagu cuauacaacgugcuagcuuucu ugagguaguagguuguauaguaguaaauuugaaaacauuaaacauacuauacaacgugcuagcuuucu GmorY1_scf7180000652159:291524..291592:+
scf7180000647953_9806 4570.4 76 +/- 17% 8958 yes Gmo-Mir-281-1-5p dps-miR-281 ugucauggaauugcucucuuug aagagagcuguccgucgacaguc aagagagcuguccgucgacaguccaguucagacauauuaauacugucauggaauugcucucuuug GmorY1_scf7180000647953:3329..3394:-
scf7180000652160_25883 4094.1 76 +/- 17% 8025 yes Gmo-Mir-33-5p ame-miR-33-5p gugcauuguagucgcauuguc caauacuucugcaaugcaaacu gugcauuguagucgcauuguccguguuauaaggaagaagucggccaauacuucugcaaugcaaacu GmorY1_scf7180000652160:6155773..6155839:-
scf7180000648035_10282 4043.6 76 +/- 17% 7925 yes Gmo-Mir-999-5p aae-miR-999 uguuaacuguaagacugugucu acauagucguacagaaaauauu acauagucguacagaaaauauuguguuauacgaguccaauguuaacuguaagacugugucu GmorY1_scf7180000648035:31983..32044:-
scf7180000648092_10503 3907.2 76 +/- 17% 7656 yes Gmo-Mir-2a-2-5p dps-miR-2a uaucacagccagcuuugaggagc uucuucaaaguggcugcgaaaug uucuucaaaguggcugcgaaauguuguacacagcuagauuuaauauucauaucacagccagcuuugaggagc GmorY1_scf7180000648092:45766..45838:+
I would like to consolidate the row items which are similar based on the following columns:
- mature mirbase MiRNA
- example miRBase with the same seed
- consensus mature sequence
- consensus star sequence
- consensus precursor sequence
I am wondering if there is a script (AWK, GREP, or just python) one can use do this at once. Some help please.
1 answer
I am surprised nobody told you yet not to use Excel in bioinformatics. There are jokesters on this site that take most opportunities to do so. And they are right. That aside, pandas can do what you want. It has a function to read Excel files, and the rest is simply merging multiple files by columns and throwing away rows that are not found in both files.
import pandas as pd
columns=['mature mirbase MiRNA','example miRBase with the same seed']
f1 = pd.read_excel(file_name_1)
f2 = pd.read_excel(file_name_2)
f3 = f1.merge(f2, left_on=columns, right_on=columns, how='outer')
f3.dropna(axis=0, inplace=True)
f3.to_excel(output_file, index=False)
I was too lazy to paste all the column names above, and you need to enter proper names for file_name_1/2 and output_file.
Log in to answer this question.
By excel file do you mean an excel -specific format like xlsx?
Also, can you expand on what you mean by consolidate the rows that are similar between the different files?
Others might not be in favor of this but for me as a complete beginner in this field, it was able to help me with tasks like this: ChatGPT. It might not be the most elegant way but it was able to give me some good working scripts for tasks like this and it worked pretty good. Sometimes you have to adjust a bit but if you are not that experienced with informatics and shell scripting like me, it is a good option.