miRNAseq - over-presented sequence in negative control
Hello, everyone
I have this sequence in the negative control of miRNA seq. TGGTAATACGACGTACTTAGTGT
It did not map to any references (miRNA, tRNA, rRNA, piRNA, mRNA, hg19, bacteria). I use QIAseq miRNA Library and NextSeq 550.
Any idea what it might be???
• 2,014 views
•
link
0 answers
No answers yet.
Log in to answer this question.
What is "negative control" here? Please show the fastqc slide for this one. What is the setup of this experiment? Blast suggests some sort of bacterium for this sequence, though for a short sequence this might be coincidence.
ATpoint Thanks for your reply. The negative control = Nuclease-Free Water is used as an input starting from miRNA extraction and it is processed as an independent sample through the whole process of library prep and sequencing. Thus, negative control raw sequences contain UMIs, adaptors, indexes etc. The sequence above is after adaptor trimming and UMI processing. UMI duplication level is very high (30x), suggesting that the sequence is initially not so abundant, but it is overamplified during PCR. Which part of fastqc do you mean? The sequence accounts for about 80% of all reads found in negative control.
That's exactly what happend in my analysis and I use the same kit and seq that you use. Did you discovery what it was??
Have you checked to see if that is the adapter sequence included in the kit?
that's the cutadapter v4.9 parameteres I use: cutadapt -m 18 -M 34 --nextseq-trim=20 -e 0.1
that's the adapters : 5' GTTCAGAGTTCTACAGTCCGACGATC 3' AACTGTAGGCACCATCAAT