This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Downloading the fastq files did not well going; read in the fastq files are all the same

Hello everyone,

I want to download fastq files of SRR7749705 (2×75bp). I used fasterq-dump and got 2 fastq files, SRR7749705_1.fastq and SRR7749705_2.fastq, as expected. However, all the reads in SRR7749705_1.fastq were the same sequence (ATTCCTT). Do you know how can I get forward and reverse reads separately (like other typical SRA samples) ?

Thank you very much.

fastq sra

1 answer

Looks like this submission has R1 as perhaps the Illumina sample index (7 bp) which is why you have the same sequence for all reads. So you are not doing anything wrong.

$ more SRR7749705_*
::::::::::::::
SRR7749705_1.fastq
::::::::::::::
@1
ATTCCTT
+1
BBBBBFF
@2
ATTCCTT
+2
BBBBBFF
::::::::::::::
SRR7749705_2.fastq
::::::::::::::
@1
TATAGAGCCAACAGAGAAACATTGGCTACTTTAACCACCTTAAAGCGGACTCCAGGAATATCACCTACAGCATGAC
+1
BBBBBFF<F/F/FFBB/FF/FBF<FBBB</FF<FFF/BB/F/FFB<BF/BFFFFFF<FFF</<BFB/<BFFBB/FF
@2
TGACATGACGTTGTTGGCATACAGGTCCTTCCTGATGTCGATGTCGCACTTCATGATGCTGTTGTAGGTGGTCTCA
+2
BBBB/BFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFBFFFFFF<FFFFFF<B/FFFFFFFFFFFFFFFB

Thank you for your answer. I understand that 7 bp seuences are sample index sequences and I'm not doing anything wrong.

However, Since this data was generated by 2×75 paired-end sequence, I want to get both forward fastq file (consisted of 76 bp forward sequences) and reverse fastq file(consisted of 76 bp reverse sequences). How can I download these 2 fastq files.

Data may have been generated as 2 x 75 bp but it has not been submitted in one single submission based on what we are seeing above or there is some issue with this accession. If submitter's submitted each read independently that would be an odd way to do it. You may need to ask the submitters to clarify.

I could understand there may be some issue with this accession. Thank your for your help !

Log in to answer this question.