This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Exonerate fails to find match

Hi,

I'm currently using Exonerate to find a match between these two sequences (see below). The percentage of identity between the sequences at both the nucleotide (72.5%) and amino acid (90% - 3'5' Frame) levels seems quite high to me.

Here are the sequences:

query TGGAATTACCGAAATAGTTTTCAAAGCTCTCAAGACTCTGAAAGTGCGAAGAGCTGAAAAATTGCCTAGGTTTACAAATTCTGTTACAAAC\ target TGGAATGACTGAAATCGTCTTCAATGCTCGGAGAACTCTGAATGTTCTCAATGCCGAGACATTGCCCAGGTCCACAAACTCTGTGACGTAC

Exonerate call:

exonerate --showalignment yes --showvulgar no --score 0 --model coding2genome --percent 60 --query query.fa --target target.fa

I've also tried the ungapped model and playing around with the parameters (e.g. -E), but I'm still not finding any match. It's a bit confusing to me because considering the high percentage of identity, I was expecting to find a match. If anyone has any insights, hints, or ideas about why this might be happening, I'd really appreciate your input.

Thanks!

exonerate msa

0 answers

No answers yet.

Log in to answer this question.