This is a test version of Biostars. For the public version, visit https://www.biostars.org.
STAR solo set parameters for scrna-seq

Hi,

I have a fasta file similar to this

@SRR17050039.1 NB501465:544:HF2H7BGXB:1:22104:14442:1233_TCCTGAGC_barcode=NA-EEEE-AAAAAEE-EEEEEEEE-GCTG-TGCCAGA-ACGTTCAT-W202012/1
GCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTA
+
EEEEEEEEEEEEEE/EEEEEAEEEEEEE6EEEEEEEE
@SRR17050039.2 NB501465:544:HF2H7BGXB:1:22104:12136:1233_TCCTGAGC_barcode=NA-EEEE-AAAAAEE-EEEEEEEE-GCTG-GACACCT-ATTGTTTG-W202303/1
GTCCCCAGCGCTTCCCCAATGCCCAGCGGGCCTTTGC
+

I need to set a parameters for STAR solo alignment. I am really confused to find about the position of barcode + UMI in the fasta sequence. I need to set parameters similar to this for paired end.

--soloBarcodeMate 1   --clip5pNbases 39 0
--soloType CB_UMI_Simple   --soloCBstart 1   --soloCBlen 16   --soloUMIstart 17   --soloUMIlen 10
--readFilesIn read1.fq

(https://gensoft.pasteur.fr/docs/STAR/2.7.9a/STARsolo.html)

Could you help me? Thank you.

solo star

a fasta file similar to this

This is not a fasta file It is a fastq format file.

Are you sure this is single cell RNAseq data? Looking at the SRA accession this appears to be a single 37 bp read. This does not seem to align with standard 10x like read lengths.

it's single cell mars-seq. Yes sorry its a fastq file.

1 answer

This is an amazing resource and seems to contain info on the Mars-seq library design. https://github.com/Teichlab/scg_lib_structs

Keep in mind generally the R1 fastq contains the cell and UMI info, the R2 contains the mRNA read.

Log in to answer this question.