Q: --methimpute not recognized by Bismark and run in single core

/X/X/X/X/bismark/Bismark-0.24.0/bismark -s 0 -p 4 -u 0 -N 0 -L 20 --output_dir /X/X/X/X/X --nucleotide_coverage  --genome_folder /X/X/X/X_ref -1 /X/X/X/X/X/X1.trim.fastq.gz -2 /X/X/X/X/X/X2.trim.fastq.gz

Q: --methimpute not recognized by Bismark and run in single core
Q: --methimpute not recognized by Bismark and run in single core
Q: --methimpute not recognized by Bismark and run in single coreV
Q: --methimpute not recognized by Bismark and run in single core

next-gen bismark rna-seq

• 689 views • link

updated 3.4 years ago by Ram

• written 3.5 years ago by sam •

0 answers

No answers yet.

More posts like this

Validating snRNA-seq cell type by correlating with other datasets
written 10 months ago by Ben •

Hi all, I am re-analyzing data from a paper (paper 1) that finds cell type X in their snRNA-seq dataset. I want to distinguish between …
bowtie2 alignment error
written 5.4 years ago by pt.taklifi

I'm struggling to add rg-id to alignments. I use the command below bowtie2 -p 10 -k 1 -D 20 -R 3 -N 1 -L 20 …
Reading frames in python
written 5.8 years ago by Gonçalo •

Hello everyone, I have to write a function that takes a sequence of nucleotides and outputs a dictionary with the translation in all possible reading …
About Mapping Efficiency of Bisulfite aligners
written 6.6 years ago by chaudharyc61 •

Hello everyone, I am working with my own Bisulfite data generated as single-end reads. So, when i'm using Bs-seeker2 i'm getting a mapping efficiency of …
problem with SeqPrep
written 7.1 years ago by haddadfatiha62 •

Hi everybody I want to merge reads (reverse and forward) so i use seqPrep with this command : SeqPrep -f ERR770964_1.fastq -r /ERR770964_2.fastq -1 forward.fastq …
Problem with fastq file
written 7.7 years ago by kamoltip.lao •

Dear all, I tried to open the example RNA-seq raw reads by using the simple command like head, but I got the error as shown …
bowtie2-align exited with value 139 ?
written 7.7 years ago by star

I have some data and I like to run bowtie2 for them, its version is 2.3.4.3. when I run it as loop for all samples …
MECDF (Multivariate Empirical Cumulative Distribution Functions)
written 11.1 years ago by Xinsen Xu •

Hi guys, I'm trying to use the "mecdf" package to analyze some data. After I used the below script or install the "mecdf_0.5.0.tar", when I …
some problem with my RRBS data when dealt with bismark
written 12.2 years ago by hua.peng1314

Hi,I have deal with my RRBS data,but the result is strange. if I use these commands: /usr/local/bin/trim_galore --phred33 -q 10 --length 35 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2 …
Calculate The Weighted Mean Of Matrix In R: Fastest Way
written 15.8 years ago by Sirus

<p>Hello everybody, I want to create a simple R script that calculates the center of a cluster, I X={X1,X2,...,X2} is my data matrix and U={U_ik} …