This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Are we convert U to T in RNA before alignment?

Hi, I don't sure about the step of alignment my sequence with reference genome by minimap2. So I have the sequence data from RNA virus that contain U and I found the reference genome from this RNA virus in NCBI but in the genome have only T.

If I want to align my sequence and reference genome. I must be to convert U in my sequence before use minimap2 or this tools can automate convert U to T by itself?

alignment minimap2

1 answer

minimap2 can work with U's in query sequence.

$ more test.fa
>Test
GUAUUCUUGCCACGACUCAUCUCCAUGCAGUUGGACGAUAUCAAUGCCGUAAUCAUUGACCAGAGCCAAA
ACAUCCUACUUAGGUUGAUUACGAAACACGCCAACCAAGUAUUUCGGAGUGCCUGAACUAUUUUUAUAUG

$ minimap2 -a ref.fa test.fa
[M::mm_idx_gen::0.035*1.04] collected minimizers
[M::mm_idx_gen::0.046*1.49] sorted minimizers
@SQ     SN:NODE_3_length_417179_cov_50.611328   LN:417179
[M::mm_idx_stat::0.051*1.45] distinct minimizers: 181299 (99.29% are singletons); average occurrences: 1.010; average spacing: 5.336; total length: 977396
Test    0       NODE_3_length_417179_cov_50.611328      1       15      140M    *       0       0       GTATTCTTGCCACGACTCATCTCCATGCAGTTGGACGATATCAATGCCGTAATCATTGACCAGAGCCAAAACATCCTACTTAGGTTGATTACGAAACACGCCAACCAAGTATTTCGGAGTGCCTGAACTATTTTTATATG        *       NM:i:0  ms:i:280   AS:i:280 nn:i:0  tp:A:P  cm:i:23 s1:i:131        s2:i:125        de:f:0  rl:i:0

oh it so clearly. Thank you very much

Log in to answer this question.