How to find average element from a cluster from a transposon library file?

How to find not a consensus, but an average element from a cluster from a transposon library file? As I know, consensus introduces artifacts and results in kmer sets that are not in the original....

For example, I have this sequense from annotation:

>RLC_02.01.01.05.99_LTR_AVESA_chr13_1474_chr7A_311197774_311206040|RLC_02.01.01.05.99_LTR_AVESA_chr13_1474_chr2A_237772346_237781533|1871
TTATTTTGCATGCTATAATTGTATTAATACGGAAACGTTAATACATGTGTGTTTAATAAACAAACAGAAAGTTCCTAGTTAAGCCTCTCTCATAAACTAGCTCGTTGATTAACAAGATGATCAAGGTTTCCTGATCATGGACATTGGATGTTGTTAATAACGGGATCACAACATTAGTGTAATGATGTGATGAACATTCATCCGAAGTATAGCATTACGATCAAAGTCATTGAGTTTATATTGCTATAACAACTTACGAAGTGATCCTAATCCTTAGACCATGAGATCATGTCAATCACTAACACCGGAAGAGTTTCTTGATAACATCAAACGTCACACCGTAACAGGGTGATTATAAAGATGGATTCAGAACTAATAAAGTGTTATGTTGAGGCTCATGGATCGAGAGTGGAATTTGTTCATCCCGATGACGGATAGATATACTCTGGGCCCTCTCGGTGATATCACATTGATTAGCTTGCAAGCAAGTGATTTGATCACTAGAATGTTATATCACAGGAACGAGAAAAGAGTGCATGTCGGTAACGAGATCAAACTAGGTATGGAGATACCGATGATCGAATCTCGGACATGTAATATATCGTGAAACAAAGGGATTAAGATACTAGCGTAAAAGGTTCCGACGATCACAAGAAAGTCATCGTTGAATGTGTGGGAGTCAGTATGGGTCTCCAGATCCCGCTTCTGATTATTGATCTGAG

consensus transposons te

• 620 views • link

updated 3.7 years ago by GenoMax

• written 3.7 years ago by Юлия •

0 answers

No answers yet.

More posts like this

How should duplicate samples be handled when identifying super-enhancers?
written 1 month ago by G.J.W •

Hi everyone, I am analyzing **super-enhancers (SEs)** from H3K27ac CUT&Tag data and have observed some confusing results. I would greatly appreciate any advice on my …
How can I avoid artifacts in gene set/pathway scoring by UCell and similar algorithms?
written 3.5 years ago by omer.shomrat •

Hey people, I’m analyzing scRNA-seq data for mice from 6 different biological groups. I am using Seurat (“MetaFeatures”/“AddModuleScore”) and UCell/ssGSEA (via “escape”) to try and …
GOChord plot problem when using the chor_dat function to create a matrix
written 4.8 years ago by abhilashtripathi10 •

Hello All, I am trying to create a GOChord plot for circular visualization of the results of gene- annotation enrichment analysis. I created all the …
Functional enrichment analysis of bacteria
written 5.7 years ago by mickey_95 •

Hello, I have gene lists from an RNA-seq experiment from E.coli bacteria. So far, I have only worked with model organisms, which are supported by …
What is Null Pointer Exception?
written 7.0 years ago by uaakash.mumbai •

When I use different tools, I get different lists of genes! g:Profiler vs gageData and more. The thing is I have not yet been able …
Finding the official list of genes from Geneontology(GO) gene sets
written 7.1 years ago by Gabriel

Example gene set: GO:0000002 When I use different tools, I get different lists of genes! g:Profiler vs gageData and more. The thing is I have …
How to annotate repeats?
written 8.3 years ago by Zee_S

Hello Biostars community! I have a database of consensus transposon sequences for a model organism. These sequences come from diverse families and range from very …
de-novo whole genome assembly and annotation
written 9.6 years ago by kratiranjan2020 •

I have been trying to assemble a nematode genome denovo from past 6 months. I have got read libraries of different insert lengths 375bp, 500bp …
Size of the match without gaps in BlastN
written 10.9 years ago by samuelmiver

I am locating specific sequences in a genome using BlastN. The sequences (47 nucleotides of total length) include (after a filtering process) 32 original nucleotides …
Best Way To Identify Families From Individual Transposable Element Copies?
written 14.8 years ago by David M

<p>I'm currently involved in an annotation project focused on identifying as many repeats as possible in a recently assembled (1st draft) genome. Without a library …