GSNAP error: Paired-end accessions do not match
Hi,
This is my first time using GSNAP aligner. When I tried to align paired end fastq file (which contains only mitochondrial sequence) using GSNAP, I got the following error. Could anyone please guide me how I can resolve this issue.
Here are the specific reads that are causing this error.
Read1
@SRR6435655.2790253
TCTAGACCCTACCCCCAACTCCCTCCCATTAATTAGCCTTCTCTTAGCAGCAGCAGGAAAGTCAGCTCAATTCGGCCTCCATCCCTGACTCCCATCTGCCATAGAAGGCCCAGCCCCAGTCTCAGCCCTACTCCACTCCAGCACTATAGTT
+
BAA@CCB@@BB9@@@@BBBBC?@BC@@BBABBBABCB@BACBCB@BCBBCBBCBBCABCBC@CBCBCDBCCBD@AC@CCACCDAACDCCCDAACCDCDCABCCDCCDACAAC=CAAABDBCDDCDCAACCCDDACCCCACDCCCCBAAB@A
Read2
@SRR6435655.1510133
TTACTCTGCAGCCTTTCCAGGGTTTGCTGAAGATGGAGGTATTTAGGCTGGGCAAGAGGTGGTGAGGTAAATTGGGGTTTATCGATTATAGAACAGGTTCCTTTAGAGGGATATAAAGCACCGCCAAGTCCTTTGAGTTTTAAGCTGTTGC
+
A??ACDBCBB:B@BAAC@BC@@>AACBACBBCBBC@BB?@BBAABC@BBC@@BBBCBC@ADAADCD@ACCCCBDAACBBBCCD>CCBCCCDCCCCDAABCACABCDCDAACCCCCCCDCCCA@CBDDEBABDA7ED:CBCCDDDCDB?@C@
• 1,884 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Hi!do you have the same number of reads and sorted in the same order in both files?
Thank you iraun for your guidance. I haven't sorted my fastq files before, I think that's why I got this error. After sorting the fastq file and keeping only the paired reads, I was able to resolve it.
However, I'm getting the following error now.
I think it's because my reference genome has not been indexed correctly. Previously, I downloaded the indexed genome from this website (http://research-pub.gene.com/gmap/) (UCSC hg19/GRCh37)
Then I tried to index my reference genome using gmap_build, but I got the following error. Please guide me how I can resolve this issue.
Glad that you manage to advance a bit at least. Regarding the new error.. I am not sure, can you try to specify
-d chrM?Thank you iraun for your guidance. I'm able to index the reference genome correctly, also I'm able to align my reads with reference genome.