Many thanks! It worked!
Hello, everyone!
I'd like to run OrthoFinder with nucleotide input instead of protein input, but the genomes I'm working with are from an old version, then Genbank doesn't allow me to download de CDS fasta file directly from the site. So I downloaded the gbk file and I'm trying, without success, to extract all CDS from it. If someone could help me I'd appreciate it.
Those are the gb files: https://www.ncbi.nlm.nih.gov/nuccore/NC_018019.2 https://www.ncbi.nlm.nih.gov/nuccore/NC_018019.1
from Bio import SeqIO
record = SeqIO.parse(
"./NC_018019.2-complete.gb", "genbank")
record.features = [f for f in record.features if f.type == "CDS"]
SeqIO.write(cds, 'NC_01809.2_V2_nucleotide.fasta', 'fasta')
and i've the following error:
Traceback (most recent call last): File "/home/enrico/Documentos/materialcp162/dados/CDSs/nucleotideos/./getcds.py", line 7, in <module>
record.features = [f for f in record.features if f.type == "CDS"]
AttributeError: 'GenBankIterator' object has no attribute 'features'
Thank you
2 answers
Not python but you can use Entrezdirect to get the CDS sequences from the accessions you want (example truncated to save space).
$ esearch -db nuccore -query NC_018019.1 | efetch -format fasta_cds_na > CDS.fa
$ more CDS.fa
>lcl|NC_018019.1_cds_WP_014799813.1_1 [locus_tag=CP162_RS00005] [protein=chromosomal replication initiator protein DnaA] [protein_id=WP_014799813.1] [location=1..1812] [gbkey=CDS]
GTGTCGGAGGCTCCATCGACATGGAACGAGCGGTGGCAAGAAGTTACTAATGAGCTGCTGTCACAGTCTC
AGGACCCAGAAAGTGGTATTTCCATTACGCGACAGCAAAGCGCCTACCTGCGTCTGGTTAAACCAGTTGC
TTTTGTAGAGGGTATTGCCGTTTTAAGCGTTCCTCACGCCCGAGCGAAAAAAGAGATTGAAACTACGCTG
GGACCTGTTATCACAGAGGTATTGTCTCGTAGACTAGGTCGACAATACAGTCTTGCAGTGAGCGTTCATG
CTCCAGAGGAAAATCCAGAAGTATCCTCGGCCACTCCAGATGCTGTGTCTGATTACCAGGAACAATCTGC
This was already neatly solved above, but I thought it could be a good exercise to show how to do what requested in BioPython:
from Bio import SeqIO
genome = next(SeqIO.parse("NC_018019.2.gb", "genbank"))
cds = []
for feature in genome.features:
if feature.type == 'CDS':
cds.append(feature)
seqs = []
for feature in cds:
seq = genome[int(feature.location.start):int(feature.location.end)]
if feature.location.strand == -1:
seq.seq = seq.seq.reverse_complement()
seq.description = feature.qualifiers['product'][0]
seqs.append(seq)
SeqIO.write(seqs, 'CDS.fasta', 'fasta')
Using Entrez Efetch is to be preferred in any case, as it would provide reliable source data without having to do any manipulation.
Log in to answer this question.