This is a test version of Biostars. For the public version, visit https://www.biostars.org.
cutadapt output empty

This is my first time using cutadapt. After trimming adapter(AGATCGGAAGAGC) for SE 50bp sequencing reads file, I get a empty fastq file.

My command is :

cutadapt -a AGATCGGAAGAGC -o results/sRNA-seq/cutadapt/SRR8857862_cutadapt.fq.gz fastq/SRR8857862.fastq.gz

The SRR8857862.fastq.gz file like this(I added the space manually to make it easier to view ):

$ zcat fastq/SRR8857862.fastq.gz | head | grep 'AGATCGGAAGAGC'
NACGACTCTCGGCAACGGATATCTCGG AGATCGGAAGAGC ACACGTCTGA
CATCCGTCTGGCTCAGTCTCCGTC AGATCGGAAGAGC ACACGTCTGAACT
NAATGACGGTATCTGAGG AGATCGGAAGAGC ACACGTCTGAACTCCAGTC

And the log infomation like this(I honestly don't understand this log file):

$ cat logs/sRNA-seq/cutadapt/SRR8857862.log
This is cutadapt 4.1 with Python 3.7.12
Command line parameters: -a AGATCGGAAGAGC -o /results/sRNA-seq/cutadapt/SRR8857862_cutadapt.fq.gz /fastq/SRR8857862.fastq.gz
Processing single-end reads on 1 core ...
Finished in 200.24 s (9 µs/read; 6.39 M reads/minute).

=== Summary ===

Total reads processed:              21,331,325
Reads with adapters:                21,308,998 (99.9%)
Reads written (passing filters):    21,331,325 (100.0%)

Total basepairs processed: 1,066,566,250 bp
Total written (filtered):    515,957,093 bp (48.4%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGC; Type: regular 3'; Length: 13; Trimmed: 21308998 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-13 bp: 1

Bases preceding removed adapters:
  A: 18.4%
  C: 32.3%
  G: 19.3%
  T: 29.8%
  none/other: 0.1%

Overview of removed sequences
length  count   expect  max.err error counts
3       5       333302.0        0       5
4       1       83325.5 0       1
5       3       20831.4 0       3
7       3       1302.0  0       3
8       285645  325.5   0       285645
9       324846  81.4    0       324846
10      324158  20.3    1       315149 9009
11      317739  5.1     1       308296 9443
12      339889  1.3     1       329897 9992
13      376530  0.3     1       363714 12816
14      616486  0.3     1       596496 19990
15      574232  0.3     1       555528 18704
16      447063  0.3     1       432057 15006
17      500524  0.3     1       483221 17303
18      560586  0.3     1       540318 20268
19      543647  0.3     1       524023 19624
20      567565  0.3     1       545604 21961
21      516139  0.3     1       496017 20122
22      485929  0.3     1       466629 19300
23      590731  0.3     1       566924 23807
24      622773  0.3     1       596992 25781
25      623838  0.3     1       597729 26109
26      1625645 0.3     1       1558914 66731
27      789641  0.3     1       756910 32731
28      1150502 0.3     1       1103410 47092
29      1113779 0.3     1       1068052 45727
30      964253  0.3     1       924660 39593
31      1557766 0.3     1       1495846 61920
32      855010  0.3     1       820559 34451
33      584719  0.3     1       561147 23572
34      1042349 0.3     1       1001130 41219
35      274674  0.3     1       263732 10942
36      162642  0.3     1       156046 6596
37      2205326 0.3     1       2118110 87216
38      124374  0.3     1       118927 5447
39      57080   0.3     1       54734 2346
40      45116   0.3     1       43224 1892
41      30882   0.3     1       29671 1211
42      24274   0.3     1       23263 1011
43      21146   0.3     1       20289 857
44      17075   0.3     1       16332 743
45      5836    0.3     1       5595 241
46      2916    0.3     1       2792 124
47      1738    0.3     1       1656 82
48      1416    0.3     1       1363 53
49      1669    0.3     1       1593 76
50      30838   0.3     1       29419 1419

Thanks in advance!

cutadapt

According to the log file it found the primer in almost all of the sequences and wrote them to the output file, are you sure it's empty?

First of all, thank you very much for your reply.

I found that the file had been rewritten due to a problem with my subsequent analysis.

So I've solved the problem.

0 answers

No answers yet.

Log in to answer this question.