Error while running Trinity
Hello
I am trying to make an assembly of paired Rna Seq data using Trinity. Can anyone let me know why this error is coming? command I used for this
Trinity --seqType fq --max_memory 50G --samples_file sample.txt --output trinity_out_final
Error, pairs.K25.stats is empty. Be sure to check your fastq reads and ensure that the read names are identical except for the /1 or /2 designation. at trinity/trinityrnaseq-Trinity-v2.5.1/util/insilico_read_normalization.pl line 904.
CMD finished (35 seconds)
Error, cmd: trinity/trinityrnaseq-Trinity-v2.5.1/util/insilico_read_normalization.pl --seqType fq --JM 50G --max_cov 50 --CPU 2 --output trinity_out_final/insilico_read_normalization --max_pct_stdev 10000 --left 1P.fastq --right 2P.fastq --pairs_together --PARALLEL_STATS died with ret 512 at /opt/software/applications/trinity/trinityrnaseq-Trinity-v2.5.1/Trinity line 2544.
main::process_cmd("trinity/trinityrnaseq-Trinity-v2.5."...) called at /opt/software/applications/trinity/trinityrnaseq-Trinity-v2.5.1/Trinity line 3090
main::normalize("trim1/"..., 50, ARRAY(0x1035250), ARRAY(0x1035280)) called at /opt/software/applications/trinity/trinityrnaseq-Trinity-v2.5.1/Trinity line 3037
main::run_normalization(50, ARRAY(0x1035250), ARRAY(0x1035280)) called at /opt/software/applications/trinity/trinityrnaseq-Trinity-v2.5.1/Trinity line 1297
head 1P.fastq
@NS500223:171:H27KFBGXY:1:11101:1954:1054 1:N:0:ATCACGAT+AGATCTCG
ATTTGNAAATCAATTTTTAATGAGTTTTTAAATAGTAACTTTTAAAATTATTTATAAATTATTAATGCCTTTGTCAGTTATGTGTTTGGGCTGATCTAATAAAGAAAATGCGTAGCTTAAATGAACTGGTGAAATGAAATTAAATGATAC
+
AAAAA#EEEEAEE/EEEEEEEAEEEEEEEEEEEEEE66EEEEAEEEEEEEEEE/EEEEEEEEEEEEEE/EE//EEEE/EEEAEAEEEEEEEEEEEEEEEEEEEEAEEEE<E/<<<AEEEEEEEEEEE/AEEEAEEEE<EEEEEEEAEEE<
@NS500223:171:H27KFBGXY:1:11101:20901:1056 1:N:0:ATCACGAT+AGATCTCG
AGGAGNTCGAATCATCAGCCATCTTGATATAGAAATGCAAACTGAAAGTTAACCTGCTCACATTTTTTGTGTGAAGCTCCACACTGCAGCGGAAATGATCAGACGGTTTAAAGAAGCCTGCTTCAGTCGGATGACAACAGTCACTCTGTT
+
AAAAA#EEEE6EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEAAEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEE<EEEEEEEEEEEEEAEEEEE/AAEAEEEAEAE<A<<E
@NS500223:171:H27KFBGXY:1:11101:23770:1058 1:N:0:ATCACGAT+AGATCTCG
GTCCCNGTCTGGCTCTGTTGTGAAGTCCCTCATGGCTACGCAAATGGTCCTTAACCCGTCACAGGCCATTGGCTCGATCACTTTCCGCACCATCTCATCCCGATCTTTGGCCTTGAAGACACGTGGCTGGCCTGAAGCATCAAGGATATG
head 2P.fastq
@NS500223:171:H27KFBGXY:1:11101:23802:1052 2:N:0:GCCAATAT+AGATCTCG
GAAAT
+
AAAAA
@NS500223:171:H27KFBGXY:1:11101:5252:1053 2:N:0:GCCAATAT+AGATCTCG
ATTTAG
+
//AAA6
@NS500223:171:H27KFBGXY:1:11101:7775:1054 2:N:0:GCCAATAT+AGATCTCG
GATGCA
• 2,237 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Show us the headers from the R1/R2 files. Error seems to be clear.
Thank you for reply
Again, it says so right in the error message:
Your sequence headers are not identical, nor do they have the /1 or /2 designations. If all the 2P reads are the same length like what you showed, you may want to consider using just
1P.fastqto assemble as a single read.It appears that your fastq files are not even from the same dataset (beyond the fact that read 2 seems to be just an index read).
Errors usually happen because something is wrong with the command or the files. Since you didn't provide either one of those, we can only interpret the error literally. You could, too. It says that the statistics file is empty, and that you should check the fastq reads which were used to make the .stats file. So either you look into the fastq files or paste the first 10 or so lines from them for us to look. While you are at it, it may help to paste the command as well.
Thank you for your reply. I have edited my question.