This is a test version of Biostars. For the public version, visit https://www.biostars.org.
blastn difference in command line version vs webpage version

I am blasting the following sequence to a reference on both the NCBI blastn webpage and the command line tool. However, I am not able to blast using the command line tool with loose threshold.

>Query seq
CACAACTTCTTTTGTGAGTCATGTGACTCTTATGGTCCAGGTAACACATTTATTAACGATTACGTTGCAAAGGAAGTCT

>Ref seq
NC_002645

On the webpage version, if change the Expected value from 10 to 100, then I got three hits in return. Here is one of the example hit. enter image description here

In the command line version, I input the following in linux system and got no hit.

blastn -query test_probes -subject NC_002645.1.fasta -evalue 100 -outfmt 6

Other query sequences that are more matched to the reference sequence (evalue<e-28, out of the sequences I tried) can be returned (blastn is working at least).

I want to run blastn in command line with loose threshold/ higher expect value but I cannot. Anyone knows what is the problem here? Thanks!

command line linux blast
• 1,087 views • link
updated by GenoMax GenoMax • written by yinglin1202 • yinglin1202

1 answer

You need to use blastn-short task since your query sequence is short. First hit matches one you posted above (output below is truncated) :

$ blastn -task blastn-short -query query -db NC002645 -evalue 100 -outfmt 6
query   NC_002645.1     100.000 15      0       0       22      36      6902    6916    0.001   30.2
query   NC_002645.1     100.000 12      0       0       4       15      4537    4526    0.092   24.3
query   NC_002645.1     89.474  19      2       0       7       25      6721    6739    0.37    22.3
query   NC_002645.1     100.000 11      0       0       47      57      12125   12135   0.37    22.3
query   NC_002645.1     86.364  22      3       0       49      70      1108    1087    1.4     20.3
query   NC_002645.1     100.000 10      0       0       1       10      9325    9334    1.4     20.3
query   NC_002645.1     100.000 10      0       0       47      56      9600    9609    1.4     20.3
query   NC_002645.1     100.000 10      0       0       6       15      11190   11199   1.4     20.3
query   NC_002645.1     92.308  13      1       0       59      71      519     507     5.7     18.3
query   NC_002645.1     100.000 9       0       0       24      32      1197    1205    5.7     18.3
• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this