get your data as FASTA instead of GenBank then you can extract sequences from it in different ways

wherever you get GenBank usually you can get FASTA files as well. You can also covert GenBank to FASTA with various tools, you could use the bio package see: https://www.bioinfo.help/ to transform into fasta

bio fetch NC_045512 | bio fasta > genome.fa

now index the FASTA file:

samtools faidx genome.fa

and after that, you can extract any subsequence of it with

samtools faidx genome.fa NC_045512.2:100-120

prints:

>NC_045512.2:100-120
CGGCTGCATGCTTAGTGCACT

Using EntrezDirect (truncated to save space) :

$ efetch -db nuccore -id CM017728.1 -seq_start 9825652 -seq_stop 9826524 -format fasta
>CM017728.1:9825652-9826524 Coilia nasus isolate PX2019 linkage group LG22, whole genome shotgun sequence
TCGCTCTGTTGTGTTTTTGCCCCAAATGGCTCGGTAGCACTTGGGTACAAGGAGACAGAATATGATGCCG
TAGTTGGAGACCAGGATGGCGGAGGCCTGTACAATGGGGCGAGACTCGTTCCTGGTGATGTAGATAGGAA

Use following additional options when applicable.

-strand        1 = forward DNA strand, 2 = reverse complement
                   (otherwise strand minus is set if start > stop)
  -forward       Force strand 1
  -revcomp       Force strand 2

"Slicing" out regions of a Genbank is super easy with Biopython:

Slicing Genbank File by 'gene_id' range