format change from .fasta to .daa
Good Day
I would like to know if it is possible to go from a fasta file to a .daa file.
Because this file is necessary for the execution of the Megan6 Software.
How could I do it?
Thank you very much
megan6
fasta
daa
• 930 views
•
link
updated
by
Ram
•
written
by
weimabri •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
how to call variants in haploid genome
written by itsmesmb •Hi good people here, I have a haploid genome (phase)for 40 individuals e.g., 1. individual1.haploid1.fasta + its index file 2. individual2.haploid1.fasta + its index file …
-
How to calculate parsimony rate?
written by sushi •Good day! Using the Alignment Explorer in MEGA 11 software, I was able to highlight the parsimony-informative site. However, I need to get its rate …
-
Paired-end metagenomics data for MEGAN analysis
written by wangdp123Hi there, I am very interested in using the software such as Diamond and MEGAN to process the metagenomics data. The data is not 16S …
-
Modify Fasta header
written by ysas •Hello I have a fasta file with amino acids sequences, which was translated from nucleotide sequence by transeq. >CE99543_15407_1 MAV..... >CE99641_51257_1 MSQ...... I want to …
-
how i can separate mitochondrial sequences from chromosomal sequences
written by zion22Hi, I'd like to annoy you because I need your help. I'd like to know how you could separate mitochondrial sequences from chromosomal sequences. First …
-
how remove stopcodons from a GFF
written by zion22Hi Thank you so much for reading this post. First of all, I would like to say that I am very new to this area …
-
How remove gaps from gff file?
written by zion22Hello Thank you so much for reading this post. First of all, I would like to say that I am very new to this area …
-
DIAMOND blast imported into MEGAN6 has no taxonomic assignment
written by Farbod**Dear Friends, Hi** (*not native in Eng..*.) I have used [DIAMOND][1] for creating a **.daa** file after blastx my transcriptome.fasta assembly against NCBI nr database …
-
fasta file title change
written by Sean Liang •Hi there, I have a fasta file with the format like this: @t0000001 2137624 TGGAATGTAAAGAAGTATGTAT @t0000002 926007 TGTGCACGGCACACACCACGTCGACGTT @t0000003 854045 TGAGGTAGTAGGTTGTATAGTT @t0000004 544348 TGTGAACGGCAGACACCACGTCAGTGTT @t0000007 …
-
Read a single fasta sequence into a scalar variable in Perl
written by trying170 •Hi, I'm trying to learn Perl and have been given the task of taking a fasta file containing a single DNA sequence and finding all …
Have you read the manual? There is a good section on file formats, including what extra information you need to provide (e.g. taxa) in case you are starting simply with sequence files.