This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bwa , 2 files fastq to 1 sam

i have this problem, please, help me, I'm trying it too from Mac OS Catalina

I am creating a sam file, with 2 fastq files, using bwa I apply the following command

bwa mem -t 2 GRCh38.primary_assembly.genome.fa.gz V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz
V350019555_L03_B5GHUMqcnrRAABA-556_2.fq.gz
> V350019555_L03_B5GHUMqcnrRAABA-556.sam

The alignment begins to be generated, but after 15 hours, the following appears, and it generates a 0-bit sam file

V350019555L3C006R0051051033 16 chr21 9651911 29 150M * TGTTTTCTCTTTTTACAGCAAGGACAGTTTATTAAACACACTGTTTTAAACCTTATTTTTTCTCTAAATAATATTTCATATAAGTCAATATGTAGACTTTATGTATTTTTAAAATGAAGACATAGCATTCCATTGAACTTAGACAAAAAT EFFFFFFEGFFFFGEFF9FEFFFFGGFCFFFFGFFFFFFDFFFFFFFFFFFFFGAFFFCGBFDF@G@FGFFGFGFFFFGFFFFGFGFCFFFFFFFDGFGFGFFGFFFFFAFFFFFFEFFFFFFFFFFGDFFFF@FG8FF?FFFFFFGFFF NM:i:1 MD:Z:23G126 AS:i:145 XS:i:131 XA:Z:chr4,+189704487,150M,4;
[main] Version: 0.7.17-r1188
[main] CMD: bwa mem -t 2 GRCh38.primary_assembly.genome.fa.gz V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz
[main] Real time: 26995.284 sec; CPU: 33394.341 sec
zsh: command not found: V350019555_L03_B5GHUMqcnrRAABA-556_2.fq.gz

I have previously analyzed the files with fasqc, and they seem correct

What is happening, what should I do? Genom is online now Report Post

bwa

1 answer

If the second file is really in a new line then bwa runs only on the first file, send the output to stdout (so to screen) and the second file is being interpreted as a new command (obviously one that does not exist). If you want to have commands spanning multiple lines then you have to indicate that with \.

this is the syntax i have entered

bwa mem -t 2 GRCh38.primary_assembly.genome.fa.gz V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz

/ V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz

V350019555_L03_B5GHUMqcnrRAABA-556

.sam

is it ok?, in any case I will confirm the results that you show me when you have done it

No that is not OK. As ATpoint said above put the entire command on one line (it can wrap around automatically in your terminal ) or use the back slash at end of first line

bwa mem -t 2 GRCh38.primary_assembly.genome.fa.gz V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz \

V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz >  V350019555_L03_B5GHUMqcnrRAABA-556.sam

My recommendation is to spend some time first on Unix basics, there are many guided tutorials on the web before continuing. You must know the basics before diving into analysis.

I saw something in the bioinformatics subject, but not much. I follow the instructions of a bioinformatician, who gave me these commands. If something occurs to you, can you recommend it to me?

Log in to answer this question.