This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How can I see SNPs if I have the following data?

Hello, everyone!

I need to find SNPs, if they are present, in Coronavirus Spike Protein sequence in the given SRA file. I happen to come up with two options to do so (they may be primitive due to the fact I am new to bioinformatics), please take a look at them and give me some advice, if you can.

--- First option ---

I have two FASTA files with gene sequences. One is reference from NCBI ("sequence.fasta" - spike protein gene sequence), and the other one ("retr_seq.fasta" - probably the spike protein gene sequence) is derived from SRA file (SRR17592110 is the SRA file, and the local database ("SRR17592110.fasta") made out of SRR17592110.fasta was used to retrieve gene sequence) via Magic Blast:

magicblast -query sequence.fasta -db SRR17592110.fasta

The Magic_BLAST gave me a sequence I called "retr_seq.fasta", which I believe, is the gene sequence that was stored in the SRA file - correct me if I'm wrong.

Here are the contents of retr_seq.fasta:

>NC_045512.2:21563-25384    16  909666NC_045512.2:21563-25384   16  909666  1   255 2743S156M923S   *   0   0
TTATGTGTAATGTAATTTGACTCCTTTGAGCACTGGCTCAGAGTCGTCTTCATCAAATTTGCAGCAGGAT
CCACAAGAACAACAGCCCTTGAGACAACTACAGCAACTGGTCATACAGCAAAGCATAATTGTCACCATTA
CTATGGCAATCAAGCCAGCTATAAAACCTAGCCAAATGTACCATGGCCATTTTATATACTGCTCATA...

Here are the contents of sequence.fasta:

>NC_045512.2:21563-25384 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT
TACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGT
TTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTC
TCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTG...

How can I see SNPs here?

--- Second option ---

According to NCBI's Magic-BLAST tutorial, I performed all the operations needed on the Coronavirus Genome from SRA and Coronavirus Genome from NCBI(as reference genome).

In the end, I get BAM and BAI files, as planned, and I want to observe the Spike Protein sequence overlapping in both datasets in the NCBI's online genome-browser-tool, but I don't see the option of "BAM Files" in the "Custom Data".

Screenshot of available options from the video Here is the Screenshot of available options from the video Options I see in my browser now Here are Options I see in my browser now

So I can't upload my BAM and BAI files to see where the SNPs are in there.

How can I do the last step of this tutorial?

Thank you very much in advance, Your help would be greatly appreciated!

blast snp magic

0 answers

No answers yet.

Log in to answer this question.