This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Subread FeatureCounts produces zero percent successfull alignment

Dear All, I working on rice genome transcriptome analysis. I have done alignment using the Hisat2 tool process greater than 80% s score. Then I perform the count matrix generation using the subread package

Commad Subread

/apps/subread-1.6.2-source/bin/featureCounts -p -B -a all.gtf -o counts  *bam

http://rice.uga.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pseudomolecules/version_7.0/all.dir/

Reference fasta file

>LOC_Os01g01010 genomic|TBC domain containing protein, expressed
AGATGAGCTGGTGGGGATGCTCTAAGAGAACGAGAGAAGCACAGAGCAGATAAACCACAC
CCACAGGCACCACCGTCCTTGTTGGTAATGAAGAAGACGAGACGACGACTTCCCCACTAG
GAAACACGACGGAGGCGGAGATGATCGACGGCGGAGAGAGCTACAGAAACATCGATGCCT
CCTGTCCAATCCCCCCATCCCATTCGGTAGTTGGATTGAAGACTACCGAATAAGAGAAGC

GTF file all.gtf

Chr1    MSU_osa1r7  exon    2903    3268    .   +   .   transcript_id "LOC_Os01g01010.1"; gene_id "LOC_Os01g01010"; gene_name "LOC_Os01g01010";
Chr1    MSU_osa1r7  exon    3354    3616    .   +   .   transcript_id "LOC_Os01g01010.1"; gene_id "LOC_Os01g01010"; gene_name "LOC_Os01g01010";
Chr1    MSU_osa1r7  exon    4357    4455    .   +   .   transcript_id "LOC_Os01g01010.1"; gene_id "LOC_Os01g01010";gene_name "LOC_Os01g01010";

enter image description here

enter image description here

zero subread featrurecounts alignment

1 answer

As you can see in your files the FASTA file does not match the GFT file

Now how you reference file calls the sequences >LOC_Os01g01010 whereas the feature file designates them as Chr1

Make sure to use a genomic file, not a transcriptome file as your alignment target.

Log in to answer this question.