Hello everyone, I have copied a segment of a known DNA sequence and I want to turn this segment of DNA into a FASTA file in order to BLAST it against a custom made database. I mostly work in the web-based GALAXY tool. Is there any program or site out there that can produce a FASTA file for me? Thank you!
•
written
by
rupjandu •
1 answer
A fasta file is simply a text file with a simple but specific format, consisting of the following: a single header line starting with a ">" character, followed by text of your your choice, such as a sequence identifier, or sequence coordinates, and then the lines following the header are the DNA sequence itself. For example:
>chr2L:250-350
TTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTG
CCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCG
The length of the sequence lines is unimportant. The main idea is a header line, followed by sequence line(s). Make sure it is a simple text file, ascii characters only (not Microsoft Word, etc.).
Log in to answer this question.
-
Error: Duplicate seq_ids are found
written by rupjandu •
-
How to create a local (custom) database with a multifasta DNA sequence file in Prokka?
written by fdelgadillo •
-
How to upload a custom genome build at Galaxy
written by vidar.blikstad •
-
Blast wrong, RNA seq
written by apl00028
-
Easier Method to Make a Bioinformatics Pipeline Available on the Web
written by skim •
-
BLASTing long sequence
written by igor
-
Need A Public Canonical Dna Alignment Problem With Known Good Solution
written by daniel.wilkerson •
-
Protein Protein Or Protein Dna/Rna Interaction Prediction
written by Pappu
-
Custom Blast Db On Galaxy Server
written by Zach Powers
-
How To Score For The Repetitiveness Of A Dna Sequence?
written by 2184687-1231-83-
