I use the tRNAscan-SE v2.0.9 for trna prediction. One of the trna predicted is trnG-GCC (with CORE 16.5). The sequence is shown below at coordinate 91435-91506: AGCGGAAGGATGAACCCTCAACCTCAGCCTTGGCAAGGCTATGCTCTACCATTAAGATTAAGCTATTTCCGC

I also use MITOFY webserver for annotation. The same trnG-GCC (with CORE 25.78) was predicted by the tRNAscan-SE v1.3.1 used in MITOFY but slightly a bit different in coordinate (91431-91501) as shown below: CAAGAGCGGAAGGATGAACCCTCAACCTCAGCCTTGGCAAGGCTATGCTCTACCATTAAGATTAAGCTATT

There are a total of 4 such trna with slightly different coordinate predicted by tRNAscan-SE v2.0.9 and tRNAscan-SE v1.3.1. May I how to determine which coordinate to use for this case? based on those with higher CORE?