Annovar output no comment column?
I have run the Annovar to annotate my GWAS results. My input (a list of rsID) was converted to avinput first by:
convert2annovar.pl -format rsid GWAS_rsID.txt -dbsnpfile ../../humandb/hg19_snp138.txt > snplist.avinput
Then I run the command to annotate:
annotate_variation.pl -filter -out ex1 -build hg19 -dbtype snp138 snplist.avinput ../../humandb
It was running, but my output didn't include the information I need. The comment column didn't tell any functional or annotated gene information. It only outputs the matched rsID. It is odd. Could someone help?
[user@login PATH]$ head -100 ex1.hg19_snp138_dropped
snp138 rs201106462 chr1 10329 10352 ACCCCTAACCCTAACCCTAACCCT - rs201106462
snp138 rs77366501 chr1 100858 100858 T C rs368741663
snp138 rs11584349 chr1 1000156 1000156 C G rs11584349
snp138 rs11584349 chr1 1000156 1000156 C T rs11584349
snp138 rs9442365 chr1 1000643 1000643 C G rs9442365
snp138 rs75316104 chr1 1000760 1000760 G A rs7531610
• 839 views
•
link
0 answers
No answers yet.
Log in to answer this question.