This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Annovar output no comment column?

I have run the Annovar to annotate my GWAS results. My input (a list of rsID) was converted to avinput first by:

convert2annovar.pl -format rsid GWAS_rsID.txt -dbsnpfile ../../humandb/hg19_snp138.txt > snplist.avinput

Then I run the command to annotate:

 annotate_variation.pl -filter -out ex1 -build hg19 -dbtype snp138 snplist.avinput ../../humandb

It was running, but my output didn't include the information I need. The comment column didn't tell any functional or annotated gene information. It only outputs the matched rsID. It is odd. Could someone help?

[user@login PATH]$ head -100 ex1.hg19_snp138_dropped 

snp138  rs201106462 chr1    10329   10352   ACCCCTAACCCTAACCCTAACCCT    -   rs201106462
snp138  rs77366501  chr1    100858  100858  T   C   rs368741663
snp138  rs11584349  chr1    1000156 1000156 C   G   rs11584349
snp138  rs11584349  chr1    1000156 1000156 C   T   rs11584349
snp138  rs9442365   chr1    1000643 1000643 C   G   rs9442365
snp138  rs75316104  chr1    1000760 1000760 G   A   rs7531610
annovar gwas annotation annovar post-gwas

0 answers

No answers yet.

Log in to answer this question.