how to find Gene ontology
I am a beginner pls help me if i have a sequence or FASTA file how to find Gene ontology
go
• 902 views
•
link
updated
by
jared.andrews07
1.9K
• |
written
by
chinu
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Disease-Disease Association data
written by singhankit973 2I am working on a deep learning model for predicting disease gene associations, for that i am using disease-gene association data primarily and supplementing other …
-
Gene Ontology question
written by Bhawna 0Hello! I am new to Gene Ontology. I have a couple of lists of common DEG's from a couple of diseases. I want to shortlist …
-
FASTA File Concatenation
written by Yarabi 0Hello, I am a beginner in bioinformatics and I am currently doing gene mapping of viral RNA sequences. And I have the following question: How …
-
How to retrieve a gene sequence from SRA file?
written by Askhat 0Hello, everyone! I am new to bioinformatics with biology-and-genetics background. So I desperately need a good advice. I am trying to retrieve a "spike protein" …
-
Find unique sequence within
written by rksmerge1234 0How to find a unique sequence in within a sequence and compare it with other databases? I don't know if that sounds correct but I …
-
How to perform gene ontology analysis with list of upregulated and down regulated genes?
written by John 28Hi, I have found ~3000 upregulated genes and ~3000 downregulated genes using RSEM & EBSeq. Using this gene list, how can I perform a Gene …
-
Finding Kmers From Fasta File
written by ahmed.jutt2012 3Can anyone help me .. how to find k-mer of 4 from a fasta file in Python3 .. Thanks in advance i'm a beginner ...
-
How to remove the header line with ">" in a fasta file
written by bright602 5Hi, I am a beginner in bioinformatics. I have a fasta file like below (plz ignore the "|") > Chr3:183153228-183153246 TGGAAAGGACGAAACACCGCG > Chr3:183286843-183286861 CTAGAAATAGCAAGTTAAA How …
-
BLAST multiple sequences against each other from one FASTA file
written by Keely 0Hi, I am a beginner to using BLAST locally on Mac OSX. I have downloaded ncbi-blast-2.2.31+.dmg and have installed it. I have a FASTA file …
-
How To Align The Reference Sequence With The Contigs ?
written by Arpitha Hebbar 22<p>i have a fasta file with 113 contigs and a reference sequence in fasta file. i have to align my contigs to the reference sequence …
We're going to need more information than that. What does the sequence represent? A gene? A transcript? Are you trying to perform enrichment analyses or infer GO terms based on sequence homology? Please edit your question to add additional details, preferably including a reproducible example, a clear description/example of your inputs & expected output, and what you've tried so far.