I am running blastX with the following:

blastx -db nr -remote -max_target_seqs 10 -outfmt  '6 sskingdoms' -query temp.fa

where temp.fa is the file (actually, more a txt than fa since I did not include the header) with the sequence, for instance:

ACGAAACCTATAGAGGATATTGGAATCGTCGTGTTGGATAACAAGCAGATAACTATCACTTCCGGTGTGCTGGAGGCTTTGCTTGAGAACAACTGTTCCGT

I get the warning

Warning: [blastx] Taxonomy name lookup from taxid requires installation of taxdb database with ftp://ftp.ncbi.nlm.nih.gov/blast/db/taxdb.tar.gz

But I also preceded the analysis with

export BLASTDB="~/blast/bin"

where the taxdb.btd and taxdb.bti are present.

How can I sort this error?