i download and give the permission but after running it say
faSomeRecords: command not found
• 0 views
•
link
so i use and run my fasta file in my terminal using orfipy like:-
orfipy normal.fasta --dna orfs.fa --min 300 --max 10000 --table 1 --outdir orfs_out
$cat orfs.fa
>MSTRG.942.2_j_ORF.1 [85-439](+) type:complete length:354 frame:2 start:CTG stop:TAA
CTGTTGAGTATAGATTCCTTTTTCACTCAgtaagcaaaaaaaaaagtagatctGAAACCCAT
CTTTCTATCAAGAACCCCCAGCTCCATTTCCACGCCCCATCTCCGGCCTCCGCGACACATAT
ATCCATTTTCGTGCTCTTCATCTCCTAAGCTTTCATTTGAACCGAATAAATCAACTTTTGAA
GCAACTTCGTGGTCAACCCATTTTCTTCCCTTCCCGGTAATACTCTTTTTCCGGTCACCTTT
CCTCTTTTCTTCCTTCTCTCTTACCtatttattccttttttttgtctttcaaaACTGTAGTT
TTTgtcctttttattttcttcttctagaTGCATTTTTTATTCCT
orf.fa is the subset of original fasta file, so after analysis i want remove these subset fasta file from my original file
any suggestion how to do it?
Use faSomeRecords utility from Jim Kent (Linux version linked). Add execute permissions after downloading (chmod a+x faSomeRecords).
faSomeRecords - Extract multiple fa records
usage:
faSomeRecords in.fa listFile out.fa
options:
-exclude - output sequences not in the list file.
So you can do
faSomeRecords -exclude normal.fasta orfs.fa wanted.fa
Log in to answer this question.
i physically check it is not working because may be header is differenet in orfs.fa and normal.fasta
so any method to remove header part like( _ORF.1 85-439 type:complete length:354 frame:2 start:CTG stop:TAA ) in orfs.fa?
See if this works:
wanted.fa gives same sequence in normal.fasta so any help
See the following. You need to keep in mind that
MSTRG.944.3_jis no longer unique so it is going to remove multiple sequences which have that id. I took the example below from the other thread you had posted this morning.if i converted two fasta file into txt and use
can it work?
Fasta files are plain text. I demonstrated how to make this work (with your own data) in example above.
it is normal confussion in my mind like
in FASTA sequence if one header file contain one or two ORF from some postion to another, so i delete whole header or that position only?