Similarity Score Increase Or Decrease After Translation In Blast · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Similarity Score Increase Or Decrease After Translation In Blast

Hi, I have a query regarding BLAST specifically blastn and blastx, Why may similarity scores go UP or DOWN after translation ? For example, the percent identity for a sequence in basic blast is 99% whereas in blastx the score is 100%. Why, what causes the change..Why is this please ? I would very much appreciate a detailed explanation please. Thank you

blastn

• 3,753 views • link

updated 10.6 years ago by Biostar

• written 12.5 years ago by Jo- Carpe Diem •

1 answer

Simple answer: the genetic code.

The same amino acid may be encoded by different codons. So for example, a query sequence may contain CCC, the subject sequence CCA. Not identical at the nucleotide level but when translated to protein, both codons encode proline, so identical as protein sequence.

• 253 views • link

written 12.5 years ago by Neilfws

Thank you! It's always the simplest things that get us thinking

• 0 views • link

written 12.5 years ago by Jo- Carpe Diem •

Log in to answer this question.

More posts like this

Blast reads classification
written 3.2 years ago by Giulia.cosenza •

I am using MagicBLAST to classify reads obtained from NGS analysis on highly degraded DNA samples. I chose to use MagicBLAST because I read that …
Blastn for converting the circular IDs
written 3.7 years ago by seta

Dear all, I’m analyzing the [GSE207093 ][1] (circular RNA microarray dataset) that is generated by Arraystar platform. As I did not find any way for …
Blastp results
written 4.2 years ago by lukhanyomakhabane •

Hello everyone Quick question, I got my blastp results here using CLC. Blastp outputs in CLC are E-value, Bit score, % identity. Query coverage is …
Help interpreting BLAST results? (Max score/Percent. Identity/E-values)
written 5.9 years ago by cia •

Hi everyone! It's my first approach to BLAST and to comparative genomics, and I would appreciate some help. I understood the theoric part of what …
Difference between NCBI Blast and Bio.Blast
written 7.3 years ago by saingamp •

Hello, I am trying to use Bio.Blast to perfrom blast similar to NCBI web-based blast. I got code from previous post and revised some to …
Salmon unmapped reads
written 8.7 years ago by Sharon

Hi All I have some samples with low mapping in Salmon (40% and less) that have higher alignments in Tophat, and trying to troubleshoot. I …
blastn query coverage filter
written 10.0 years ago by fortwatts •

I have test.fasta consisting of a single header and read: \>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATCGATCGATGTACAGCTACG TACGTCGAGATCAGAGTGA Using this as the query in the latest version of blast+ and …
how much can you rely on local blast result for gene annotation in metagenomics samples?
written 10.1 years ago by kelvinfrog75 •

I have a contig file from the assembly of Illumina shotgun reads of soil samples. I did a local blastx against the virulence gene of …
Blast "Max Matches In A Query Range" Option
written 12.5 years ago by ha.hassanzadeh •

<p>Hi Everyone, This is the first time I'm going to try such a web site to see if it works or not, hope it works!</p> …
Bl2Seq/Blastall And The E Value Help
written 15.2 years ago by Gturco •

<p>I am using bl2seq(2.2.25) to blastn two fasta files. I am not sure I fully understand how the (-e) parameter works. </p> <p>I thought the …