Now I see. The removed base is the 222635. But, can this gene be translated successfully? I mean, the base 222635 has caused a frameshift mutation and this fasta just wants to note there was a gene here. Or, this base will be removed by the organism during transcription or translation.
What Does "One Base Removed To Allow Translational Frameshift" Mean In A Sequence Description?
>YBL005W-B YBL005W-B SGDID:S000002147, Chr II from 221330-222634,222636-226598, **one base removed to allow translational frameshift**, transposable_element_gene, "Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid-like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes"
ATGGAATCCCAACAATTATCTCAACATTCCCCGATTTTTCATGGTAGCGCCTGTGCTTCG........TTAACAAACAAATGGATTCATTAG
The fasta annotation shows as above. I used to think that the fasta sequence will have one base removed when compared with the chromosome. But then I find the fasta sequence is exactly same as the chromosome and nothing removed. Now I don't know what does it mean. Hope you can help me. Thanks~
• 3,434 views
•
link
1 answer
I think "one base removed" refers to when the gene is translated into protein, not the nucleotide sequence itself. You can see the sequence of this gene in NCBI sequence viewer, here.
Note the "A" highlighted in green in the second line, that is the "base removed to allow translational frameshift".
• 189 views
•
link
• 0 views
•
link
Log in to answer this question.
The annotation says
221330-222634,222636-226598what is at position222635in your genome?ACCTTCACCTTAGGCCAGGAACT It is an A in position 222635.