This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Problems With Breakdancer

Hi I used the breakdancer in the same order. Where the first sample was a treated condition with possibly multiple deletions and translocations but when I see the output it only shows supporting information from only the normal sample.

Here are the steps that I have tried to use.

My normal file is : AddOrRep_HN002.bam My Treated condition is : Sorted_nanomax.bam

I had used picard AddOrReplaceReadGroups.jar for both the files. Yet when I run the bam2cfg.pl using the order given in the manual for tumor and normal bam file. I get the following cfg file which does not seems to have information about the treated file but only has info about the normal sample :-

#Command : bam2cfg.pl -g -h treated.bam AddOrRep_HN002.bam > Sorted_nanomax.cfg

################################################## \n readgroup:HN002 platform:Illumina map:AddOrRep_HN002.bam readlen:90.00 lib:HN002 num:10001 lower:415.71 upper:535.14 mean:476.15 std:14.93 SWnormality:-21.23 flag:0(2.00%)1(0.14%)18(94.42%)2(1.0 5%)32(1.19%)4(1.05%)64(0.12%)8(0.04%)21142 exe:samtools view #######################################################

So when I run breakdancer-max I only get rows with readgroup information coming from the normal sample file. What should I do to get the that from the treated sample also. Here is the final output and command used.

#Command: breakdancer-max -q 10 -d Sorted_nanomax.ctx Sorted_nanomax.cfg

#Chr1\t Pos1 \tOrientation1\t Chr2 \t Pos2 \t Orientation2 \t Type \t Size \t Score \t num_Reads \t num_Reads_lib \t AddOrRep_HN002.bam\n Gm01 \t 1 \t 276+325- \t Gm01 \t 2297 \t 276+325- \t ITX \t -309 \t 99 \t 93 \t AddOrRep_HN002.bam|93 \t NA\n

I'd need a little bit more information to try to solve this.

What version of Breakdancer are you using?
What do the headers of your BAM files look like?

I'd also be curious to know if you got output from bam2cfg when only providing the tumor sample file.

No actually I don't get any output with the treated sample file.

I think you have to provide the bamtocfg script with two files one tumor and one normal in the order provided.

Your error log looks normal to me for bam2cfg. There is no requirement as to the number of BAMs passed to bam2cfg. It is not specifically geared towards tumor/normal pairs only. You can use as few as one and as many as will run successfully on your machine.

There is likely to be something not quite right with your BAM file. Can you post your BAM files' header? An example read? Did you do any sort of filtering of the reads before passing to BreakDancer? bam2cfg needs normally paired readpairs in order to function properly.

Hi here is the header of bam file : -

@HD    VN:1.4    SO:coordinate
@SQ    SN:Gm01    LN:55915595
@SQ    SN:Gm02    LN:51656713
@SQ    SN:Gm03    LN:47781076
@SQ    SN:Gm04    LN:49243852
@SQ    SN:Gm05    LN:41936504
@SQ    SN:Gm06    LN:50722821
....................................................
@SQ    SN:scaffold_2282    LN:1015
@SQ    SN:scaffold_2287    LN:1003
@RG    ID:nanomax    PL:Illumina    PU:nanomax    LB:soybean_nanomax    SM:nanomax    CN:MU

Here is how one of the reads look like :-

HWI-700167R:491:C2YC8ACXX:3:1101:10000:12770    77      *       0       0       *       *       0       0       AATTTAACTGGTTCAATATCAGAGTACAATCTTACAACAGGAATTTTATTTCTTTGAAAAAAAATATAAGCAAAAATATTTAGCTAATGCAATAGGGGCA    CCCFFFFFHGHFHJJJJJJJJIGIEHIHIJIIIJJHIJJIJIIIJIJGJJJIJJJJEHJJJJIJHHHGHHHFFFFDCCEEEEDDDEDDDDDDDDA@(8@B        RG:Z:nanomax    AS:i:0  XS:i:0

This read (and its mate) are unmapped and BreakDancer's bam2cfg would ignore it. Do you have reads that are mapped in this file? What does samtools flagstat report on the BAM file?

172343366 + 0 in total (QC-passed reads + QC-failed reads) 0 + 0 duplicates 0 + 0 mapped (0.00%:-nan%) 172343366 + 0 paired in sequencing 86171683 + 0 read1 86171683 + 0 read2 0 + 0 properly paired (0.00%:-nan%) 0 + 0 with itself and mate mapped 0 + 0 singletons (0.00%:-nan%) 0 + 0 with mate mapped to a different chr 0 + 0 with mate mapped to a different chr (mapQ>=5)

I just checked it and it shows no reads mapped. I ran it using bwa-mem with default options looks like I need to try some other aligners

That explains it then! Once you have properly mapped reads, bam2cfg should work.

Here is the error log :-

[Fri Jan 31 20:18:33 2014 /home/skhan/bio/Breakdancer/breakdancer/perl/bam2cfg.pl] Processing bam: addRG_nanomax.bam
[Sat Feb  1 01:03:08 2014 /home/skhan/bio/Breakdancer/breakdancer/perl/bam2cfg.pl] Closing BAM file
[Sat Feb  1 01:03:08 2014 /home/skhan/bio/Breakdancer/breakdancer/perl/bam2cfg.pl] Send TERM signal for 45002
[Sat Feb  1 01:03:10 2014 /home/skhan/bio/Breakdancer/breakdancer/perl/bam2cfg.pl] samtools pid process 45002 is still there...
[Sat Feb  1 01:03:10 2014 /home/skhan/bio/Breakdancer/breakdancer/perl/bam2cfg.pl] invoking kill -9 on 45002 ...
[Sat Feb  1 01:03:10 2014 /home/skhan/bio/Breakdancer/breakdancer/perl/bam2cfg.pl] Closing samtools process : 45002

0 answers

No answers yet.

Log in to answer this question.