How To Stitch Maf Blocks

Dear Biostars,

I am using Galaxy "stichMAFBolcks" option against my genomic intervals (mm9). Surprisingly I am getting gaps in my reference sequence (mouse-mm9). But this can not be. Does any one know what is the problem here ?

>mm9.chr1(+):24618995-24619003
--------
>hg19
--------
>panTro2
--------
>rheMac2
--------
>tarSyr1
--------

maf

• 2,406 views • link

updated 7.1 years ago by Biostar

• written 12.7 years ago by biorepine

0 answers

No answers yet.

More posts like this

Multi-Sequence Alignment For Many Groups Of Genes
written 12.6 years ago by biolab

Dear all, How to make muli-sequence alingment for many groups of genes? I make an example here. <pre><code>>gene1_human ATTTGCGTGACTGACTGC >Gene2_human GCGCGCATGATCCGATGACTG >gene3_human TGATACGATGCTGACTGACTGAC ...... >gene1_fly …
How To Count Stand-Specific Paired-End Rna-Seq Reads Overlapping Known Protein Coding Genes ?
written 12.6 years ago by biorepine

Dear Biostars Does any one how to overlap stand-specific paired-end RNA-Seq reads (BAM) with known protein coding genes (BED) ? I tried the following but …
Tophat - Htseq Count? How Can I Improve The Mapping Percentage For Single End Reads
written 12.7 years ago by k.nirmalraman

Dear All, Probably this is a novice question. I have single end reads of size 100bp from Illumina TruSeq sequencing. I am using mouse genome …
Galaxy "Stitch Maf Blocks" Produced Null Bases
written 12.9 years ago by lam •

problem: "stitch MAF blocks" produced NULL bases steps: From <a href='http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chrY:23310464,23331995'>http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chrY:23310464,23331995</a> we got the following bases: <pre><code>agtttacccaactcacaggtatttgaggatacaaacccatgactgggcttggctttaaaaattcctatctgaaatttctagt.......... </code></pre> We want to do multiple-species alignment …
Programming Challenge: Divide The Human Genome Among X Cores, Taking Into Account Gaps
written 13.0 years ago by Jeremy Leipzig

Develop a tool that divides the hg19 human genome (1-22XYM) to distribute among different cores or nodes. The goals should be: <ul> <li>divide the genome …
Ensembl Annotation
written 13.2 years ago by essell22 •

I'm looking to annotate my genomic data that is in a bed-like format ex. <pre><code>> Chr1 200 4000 ... </code></pre> I would like to …
Chromosome Position From Ucsc Genome Browser
written 13.9 years ago by Gjain

Hi all, I am looking for the coordinates of all the chromosomes in a particular species from ucsc genome browser. for example, in HG19: …
Problem With Iranges And Findoverlap
written 14.2 years ago by e.karasmani •

Dear All, I have a small problem with Find overlaps function of IRange. I am trying to make the overlap between my peaks and the …
Goseq With Mouse Gene Id'S, Does It Work For Anyone?
written 14.2 years ago by ethanford •

Is anybody able to use the Bioconducter goseq package with mouse (mm9) gene id's? It works fine when I use hg19 gene id's but when …
Finding An Genomic Intervals Shared For A Given Individual As Called By Two Or More Algorithms
written 14.7 years ago by Ryan D

Sorry for the rather inelegant title. An example may illustrate this best. Given a dataset where genomic intervals have been identified by one or more …