HI, I have a question and need to solve it.
Followings are two fastq files.
File 1 includes all the forward read sequence (more than 400,000,000) produced by NGS Illumina platform.
File 2 includes all sequence reads (more then 4,800,000) from one specified barcode (TGACCTTG).
File 1 does not include barcode sequence in the ID identifier as showed as (#0/1) and File 2 has barcode sequence in the second line of sequence. So file 1 can not be split by barcode directly but by file 2 because file2 has similar ID identifier as file1.
Does anybody has script or tools to split file1 using corresponding ID identifiers in file2? I do not have strong bioinformatics background on this.
File1
@IPAR1:2:1:4029:1196:1#0/1
ATTTTGCCACATACAAAAGAATCTACGTTCTTCTCAGCACCTCATGGAATCTTCTCTAAAATATATCATATAATAGGACACAAAAGAA
+
BHGHHHHHHHHGDDFHHHGGDGHFHFHHHHGD>GEEG>GFHHHHFHBBHFHHHHEHHHHHHBAFHHBBEHHHFEHGBECEHFHHFAHF
File2
@IPAR1:2:1:4029:1196:1#0/2
TGACCTTGATCTCGT
+
HIHIIGIIIH8CCDC
•
written
by
Tonyzeng •
Sorry I am afraid i did not explain my question clear.
I need to pull the reads from File 2 (more then 400,000,000) which are corresponding all reads (more then 4,800,000)in File 2.
The similar ID idenfier of file1 and file2 can help us to split/pull reads of file1. Does anyone has experience to do this and has script to me to do it?
File1 @IPAR1:2:1:4029:1196:1#0/1
File2 @IPAR1:2:1:4029:1196:1#0/2
do not add an answer to your question!
that just makes it look like it has been answered. Edit your question and add the new information then delete this answer!
A fast way,
1 - fetch headers from file2 that contains only your barcode(s) of interest and replace "#0/2" at the end with "#0/1" as it is in file1:
awk 'NR%4==1 {sub(/\#0\/2/,"\#0\/1"); print}' file2.fastq > file2.IDs
2 - use one of those ultra fast programs described here: How to efficiently parse a huge fastq file? to subset your file1 according to IDs, or simply use my program which is made from the python version found in the mentioned thread: https://code.google.com/p/bioman/source/browse/fastqID.py , which you can use like this:
cat file1.fastq | python fastqID.py file2.IDs > file1.sub.fastq
Thank you so much, Manu Prestat, my problem has been solved using your script.
Log in to answer this question.
