Analyzing Older Illumina Paired-End Data
Hi all, I've got some reads from mid-2010 that I'd like to re-align. I'm not sure how best to proceed. These are from a Illumina Genome Analyzer IIx. They're 40-bp, paired-end. Here's what the text file of the raw reads looks like:
@ILLUMINA-B22060_0001:6:1:2:1931#0/2
ATTGATTCGTCACGCAGATTTCGAAACATTAAATGCAATC
+ILLUMINA-B22060_0001:6:1:2:1931#0/2
`aWabGSb`^`b^a]aaaY_\aaUDUaaG[`^a\Sa[a`B
@ILLUMINA-B22060_0001:6:1:2:545#0/2
CATCGCCGATCAGGTCACTTACCCGGAGAATTTTGATAGG
+ILLUMINA-B22060_0001:6:1:2:545#0/2
X__]^V_baYO\V\DYYPX\``]BBBBBBBBBBBBBBBBB
@ILLUMINA-B22060_0001:6:1:2:1500#0/2
TGGAGGGGAGCAAAGAACCGAAGCTGAAGTTGACTTTCTT
+ILLUMINA-B22060_0001:6:1:2:1500#0/2
]_aGab`abZ[bbbaa`a^a[`a^\a\aYDH\a_IRSYX]
I'm assuming this isn't a standard fasta/fastq format, but I could be wrong. I'd like to align these with bowtie. Is there a simple way to convert these to fastq or fasta?
Thanks in advance.
• 2,263 views
•
link
1 answer
This is fastq data you have here. It looks like a sample of the reverse reads from a paired-end run. One way to check the encoding, if you are unsure, is to run your data through FastQC. If it's from an older run, you can use the option --phred64-quals with bowtie.
• 126 views
•
link
Log in to answer this question.
I reformatted your post, hope you don't mind. The data was stretched out in a single line it does not appear that's what you wanted. If this format change reflects what your data looks like then I don't see anything unusual about this fastq, and you can try the things I mentioned in my answer below. If you see something wrong then please change it back or clarify what you think is unusual about the data.