This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Bed File Help

I have a BAM file and also the related refference genome (fasta), and now I need to extract all the position for some tags, such as "GCTTCT" in the genome, and then make a custom bed file for these tags as the following:

chr1 127471196 127472363 + ...
chr1 127472363 127473530 + ...
chr1 127473530 127474697 + ...
chrx 127474697 127475864 + ...
chr2 127475864 127477031 - ...
chr3 127477031 127478198 - ...
chr5 127478198 127479365 - ...
chr7 127479365 127480532 + ...
chr7 127480532 127481699 - ...

Your help will be greatly appreciated!

Hi Alex, thank you very much for your help! I just want to extract the read count from the BAM file for the position where has the tag GCTTCT or some other tags.

Thanks Alex for your nice tools bedops. could you please help to see another error when running "bam2bed < reads.bam > reads.bed":

* glibc detected sort-bed: corrupted double-linked list: 0x0000000011982df0 **

Many thanks!

It would be easier to troubleshoot if you post a message on our forum or mailing list: http://groups.google.com/group/bedops-discuss -- please try to include a description of your platform and what installer you used, as well as other relevant details. Thanks!

Sorry, it seems that I can't post there.

the platform is ubuntu 12.04 on a x86_64 machine;

for the installation, i use the "bedops_linux_x86_64-v2.2.0.tar.bz2". I also have tried the following, but it doesn't work.

svn checkout http://bedops.googlecode.com/svn/trunk/ bedops-read-only

cd bedops-read-only

make

make install

Thanks!

1 answer

I'm not sure I fully understand what you're doing, but maybe this would work?

First, convert the BAM file to BED with the bam2bed utility:

$ bam2bed < reads.bam > reads.bed

This puts the sequence information into the twelfth column of the BED file, e.g.:

chr1    0       36      B7_591:4:96:693:509     73      +       99      36M     *       0       0       CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG    <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7    MF:i:18 Aq:i:73 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
chr1    2       37      EAS54_65:7:152:368:113  73      +       99      35M     *       0       0       CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT     <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
chr1    4       39      EAS51_64:8:5:734:57     137     +       99      35M     *       0       0       AGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCC     <<<<<<<<<<<7;71<<;<;;<7;<<3;);3*8/5     MF:i:18 Aq:i:66 NM:i:0  UQ:i:0  H0:i:1  H1:i:0
chr1    5       41      B7_591:1:289:587:906    137     +       63      36M     *       0       0       GTGGCTCATTGTAATTTTTTGTTTTAACTCTTCTCT    (-&----,----)-)-),'--)---',+-,),''*,    MF:i:130        Aq:i:63 NM:i:5  UQ:i:38 H0:i:0  H1:i:0
...

You could grep on this with your "needle" string:

$ bam2bed < reads.bam \
    | grep -i GCTTCT - \
    > filteredReads.bed

You could use awk to reorder column fields, e.g.:

$ bam2bed < reads.bam \
    | grep -i GCTTCT - \
    | awk '{print $1"\t"$2"\t"$3"\t"$6}' \
    > filteredReads.txt

This last file is no longer a true BED file at this point (as you're rearranging columns out of UCSC order) but that's up to you and your workflow.

The resulting files filteredReads.bed or .txt contain reads with tags that contain the sequence GCTTCT somewhere in them. The BED coordinates are 0-indexed.

If this is not what you're after, please clarify your question.

Log in to answer this question.