This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How I Can Find The Sequence For The Gene That I Want To Synthesize?

Hi,

I'm starting with bioinformatic, and i want ask u this question:

I have this sequence: vpnvrgmgar davylmekrg ikvritgrgr vieqslapgd kikngmqcsl rlg from "penicillin-binding protein dimerization domain / penicillin-binding protein, transpeptidase domain / PASTA domain multi-domain protein" (id= GI:383811186).

if we want to overproduce in the external environment using Streptomyces lividans as host cell. How i can find the sequence for the gene that I ask to synthesize?

Thank you in advance.

blast clustalw

How did you select that sequence? According to NCBI the GI you refer to is for a protein that is 719 aa long which seems to be made of three domains. The 667..719 region where we can find the subsequence you mention is not for the PBP dimer domain, but for a PASTAPbp2x-like2 domain. Are you trying to find proteins in S. lividans with the PASTA_Pbp2x-like domain or the PDB dimer domain? Have you tried to blast this subsequence on NCBI blast ? (Please write in proper english, that will make your questions much less ambiguous)

This is an exercise that gives us the sequence. I made a blastp to find the protein. But how do you know that there are 3 domaines?

It's provided by the NCBI database entry for the protein you provided:

Mind that the protein name is not "penicillin-binding protein dimerization domain" but "penicillin-binding protein dimerization domain / penicillin-binding protein, transpeptidase domain / PASTA domain multi-domain protein", hence e.g. the three domains. Note also that this is a predicted protein. What's the assignment about?

(Could you please edit the spelling of your posts? And of the question title?)

1 answer

So, I had a similar problem before and wrote a javascript applet to do these kinds of reverse translation queries. It is located on a personal webpage of mine an the top right corner, and is found here: http://web.ics.purdue.edu/~jtshreve/annotate.html.

Basically, you paste your amino acid sequence (no spaces or other formatting), and then do the same with some swath of nucleic acid reference that you believe the amino acid sequence original came from (I'm assuming you know you need this to answer your question). The applet tries tries to reverse translate your amino acid query in every possible configuration that follows the standard genetic code codon chart, and returns the substring of DNA nucleotides that was found in the reference as a match.

For example, if you provide the amino acid sequence:MYNE, and the nucleotide reference sequence:atatcgtatgatatatgctggcggggagcgataatgtataacgagatcgtgtagctgtgcgtatgtataaaaatctggatgcacac, it will locate the first set of matching nucleotides that could possible code for your protein:ATGTATAACGAG. Hope this helps!

EDIT: This... is more than you need. Just follow the previous comment's NCBI link, everything is there!

Log in to answer this question.