Hi, I try to extract sequences from a fastq file using the "subseq" in seqtk. But the extract file contains only the 1st sequence but no others. I am wondering whether my name.lst file does not fit with what seqtk needs. I have names of each sequence without other symbols each line in the name.lst. But the fastq file starts each sequence name with a @. Should I add @ in front of each sequence name? Or what other problem it can be?
Any suggestion is welcome. Thanks,
Chih-Ming
•
written
by
ymwur1 •
Looks like this reply might be coming in a bit too late, but here goes:
a. Like @Istvan says, the sequence with the ID might not exist in the FASTA file
b. The ID might contain a white space, in which case the characters after the white space are processed as sequence description and not as sequence ID.
c. Duplicate ID maybe?
Seems to work fine below (also test out fine with fastq files). Make sure that you are requesting the ids that actually exist.
ialbert@porthos ~
$ cat test.fa
>x1
AAAAAA
>x2
TTTTTT
>x3
CCCCCC
>x4
GGGGGG
ialbert@porthos ~
$ cat name.list
x2
x4
ialbert@porthos ~
$ seqtk subseq test.fa name.list
>x2
TTTTTT
>x4
GGGGGG
I am having the following issue with seqtk:
I know I have the following header in both my mate pairs:
$ grep -A 1 "SN618:644:H2WH2BCXY:2:2208:4695:74911" forward_paired.fq
@SN618:644:H2WH2BCXY:2:2208:4695:74911 1:N:0:CGTACTAG+GCGTAAGA
CATGAGCTCTCCTCCGTTTCTCTGTAATCTTCCCATATACCGGATGATAATTATGTATATTTTAACATGGACCCTGAAAATCTTCAACGAAAAACGCCGG
$ grep -A 1 "SN618:644:H2WH2BCXY:2:2208:4695:74911" reverse_paired.fq
@SN618:644:H2WH2BCXY:2:2208:4695:74911 2:N:0:CGTACTAG+GCGTAAGA
ATCATGGACCGTGTAGGCGGCGGTGATTCCTTTGCTTCCGGACTGATCTACGGTCTTATGACTACAGGAAATGCAGAAACTGCGGTGAATTACGGTGCTG
I have this header in my header list file:
$ cat seqtk.debug
SN618:644:H2WH2BCXY:2:2208:4695:74911
When I run seqtk on both my mate pairs, I only get output for one of my mate pairs. What would be the issue ?
$ seqtk subseq forward_paired.fq seqtk.debug
$ seqtk subseq reverse_paired.fq seqtk.debug
@SN618:644:H2WH2BCXY:2:2208:4695:74911
ATCATGGACCGTGTAGGCGGCGGTGATTCCTTTGCTTCCGGACTGATCTACGGTCTTATGACTACAGGAAATGCAGAAACTGCGGTGAATTACGGTGCTG
+
DDDBDIHHIIIGHHHIFHIIIHGEDHIIIIIIGHHIIIIIIFHIFHIHHIHHIHHHHIIHGHHHHGHHEHHEEHGHHHHIEHHIIHI?GHH1FHGHEDHI
•
written
by
ajaybabu27 •
I'd recommend asking a new question and including a link to relevant posts (in this case, the top-level post here). That way, you're letting people know you did some digging but you still have a question.
Adding your question as an answer to a different question, especially to a 4 year old question doesn't seem like the best way to go about it.
@ Ram: Thanks for the edits !
I found that it was a formatting issue with my fastq file. Seqtk works fine.
Thanks, Ajay.
Please move this to a comment on your post above. Do not add answers unless you're answering the top-level question. Steps to move your answer:
Add Comment on your post here: A: Problem Of Using Subseq In SeqtkAdd Comment buttonmoderate back in your answer here: A: Problem Of Using Subseq In SeqtkDelete PostSubmit button.Thank you!
Log in to answer this question.
