What Do The Period . Symbols Mean In The Sequence Record Of A Fastq File
Hello all, I have a funny issue with bam files where the 4th character in a lot of my reads shows up as a ".". I've never seen this before but its running havoc with my scripts. Does anyone know what causes this or what it means? Below is an example
example:
@DHT4KXP1:3:1101:2235:2028#0/1
GAA.TACTGCCAAGTCATCCGTGTCATTGCCCACACCCAGATGCGCCTGCTTCCTCTGCGCCAGAAGAAGGCCCACCTGATGGAGATCCAGGTGAACGGAG
+DHT4KXP1:3:1101:2235:2028#0/1
_a_BS\ccgggegihhgfiiighfghiihhhhhiiiihiihifhiiiiihihhihihhh[dgeeeebddd_aacc_acccccbcccccccccbbccccacc
• 5,502 views
•
link
updated
by
Istvan Albert
•
written
by
Wayne
•
written
by
Wayne
2 answers
Log in to answer this question.
More posts like this
-
How to split Illumina Hiseq 2000 paired-end fastq files?
written by Yuka Takemon •
-
Perl Command : Add A Column With Strand Information
written by biolab
-
Need A Script That Finds Whether A String In One Column Matches In Other Columns Of The Same Row
written by biolab
-
Plink Error Message :Error: Badly Defined Segment, 2 > 1
written by naktang1 •
-
Deseq No Recognizing My Row.Names
written by Alicia •
-
Creating A Simple Matrix With Perl
written by loicatraile •
-
Issues With Fastq File
written by upendrakumar.devisetty
-
Aligning Miseq With Deletions >10 Bases
written by Leszek
-
Fastq File Without Index?
written by lsvijfhuizen •
-
Simulating A Read With A Deletion Of 50 Bp Into It.
written by Gabrielw •
You might want to get a geiger counter ;). Just to be sure, it is exclusive to the fourth position of the read? What is the provenance of the data?
Some versions of the SOLiD sequencer used to put in dots into the colorspace sequence whenever the quality was too low and was unable to call a color. Used to break all kinds of tools.
I was thinking this as well, except the Q = 33 assuming Sanger scaling. Odd.
It is not just SOLiD data, I used to see this in Illumina qseq files a few years ago (when read lengths were at 75-76 bp). This was very frustrating because most tools would just die assuming it was improperly formatted data, especially with these dots at the beginning of the sequence. My assumption was that it was just bases that could not be called so I trimmed them.