Mycroft34 or Obi Griffith I am using ArrayInitiative to create the cdf file (CytoscanHD Array) in the correct format so that it can be read into makecdfenv. However the program doesnt import the probe sequence file (probe_tab) saying the header is incorrect, as well as the number of columns. The error log says
Line Number,Probe Set ID,PM X-Coordinate,PM Y-Coordinate,Error Messages 1,NA,NA,NA,The header line is not correct. 2,NA,NA,NA,This line does not have the correct number of columns. Should be 6 2,NA,NA,NA,This line does not have the correct number of columns. Should be 6.....
The probe_tab file from Affymetrix contains 7 columns Probe Set Name Probe X Probe Y Probe Interrogation Position Probe Sequence Target Strandedness Probe Type
C-3HJWD 5 0 177 GTGACCCTACCATCAAAAGGCCTGG Antisense PM
S-4TNJHT 6 0 17 GGTGGCAATACTTAAAAGGAATCAG Antisense PM The Probe type column seems to be a problem. I am reluctant to make any changes to the file. Is there a way around this? I know that your post is 3.1 years old, but I am hoping to get some help. Of course I will try env2cdf next, but the node/41 page doesnt open. Guess its been a while. Thanks for any help, anyone.
Did you try saving it to a file with save( )?
Yes; but when reloaded it is not recognized as a true cdf by bioconductor rma or similar packages, that keep on searching for the original package; but I found an alternative with Array Initiative programme. I still have to understand how to save properly my modified cdf environment, but there is no hurry.
Hmm. I see. I searched around on this topic and saw several people posting over the years a similar question. It seems that somehow using makecdfenv should be possible. But, I did not see a clear solution anywhere. So, if anyone else has successfully done this it would be great if they will post here.
makecdfenv is the end solution; but it requires a file properly formatted; in fact, it is exactly what ArrayInitiative (http://wellerlab.uncc.edu/ArrayInitiative/tutorial.html) is doing : taking the ascii cdf file originally proposed by Affymetrix as well as the corresponding probe file, to produce a dat file that your can then filter out of the unwanted probes and probesets. after reloading in ArrayInitiative the modified dat file, the programme output the modified ascii cdf file, that can then be used to produce a package with makecdfpackage from makecdfenv, or directly produce with the same package an environment usable in the subsequent array processing.
Very cool. It seems like this solved your problem. I suggest you put these details in an answer to your own question. You'll get my upvote! And, then this question can have an accepted answer.