Hi guys, How do i extract a sequences from a fasta file by taking the start and end position from a gene predicted file: here the example the file with the orf statistics is my predicted file and for example the start position for the first orf is 65 and the end is 213. and the fasta file i'm going to search those position is the other one
my predicted file looks like this
>Seq1 [organism=S.burgodofry...
orf00001 65 213 +1 2.93
orf00002 799 2328 +1 7.09
orf00003 2331 3437 +3 6.09
orf00004 3457 4044 +1 6.15
>Seq2 [organism=S.burgodofry...
orf00001 55 317 +1 2.17
orf00002 206 610 +2 5.28
orf00003 747 2408 +3 4.85
and my fasta sequence sequence look like this:
>Seq1 [organism=S.burgodofry]...
ACTGTAGATGACATGACCAGTACGATACAGAT...
....
........
>Seq2 [organism=.....]
ATGTCGTGACTAGTACGATCAGATCAGAT
.........................
..............
...
•
written
by
Jimmyk •
3 answers
If you don't mind using BioPerl, you can index your fasta file with Bio::Index::Fasta or Bio::DB::Fasta. You can retrieve the sequence as a Bio::Seq object from the index and use the subseq method to extract the sequence between start and end position.
The BioPerl Tutorial has a [?]section[?] about Bio::Index::Fasta/Bio::DB::Fasta with sample code.
I've had a similar problem before when I had to extract gene predictions from a GFF3 file. You can try to adapt the answers given in the FriendFeed thread, though the answer uses BioPython (oh, the times before BioStar...).
"Beginner's" perl way:
- Reading the table using the
splitfunction to get the column values in a list (do you need to adjust for the frame or is the starting position given 'in-frame'?) - Put start and stop positions in a hash (to keep things simple you could use
SeqX_orf0000Yas keys) - Parsing fasta files with perl: see these answers
- Getting the relevant portion of the sequence using the
substrfunction
More complicated ways involve complex data structures, BioPerl etc.
•
written
by
lexnederbragt
Log in to answer this question.
-
Naming of FastA sequences
written by Phil S.
-
Parsing A Genbank Record With Bioperl
written by robjohn7000
-
Extract Fasta Sequences Sub Sets
written by prp291
-
Extraction Of Certain Lines Which Starts And Ends With A Particular Description.
written by Abdul Rawoof
-
Linearizing Mixed Fasta
written by PoGibas
-
Reverse Complement Of A Sequence Raises Assertionerror: Invalid Alphabet Found
written by Jelena_bioinf •
-
Detecting Polymorphic Sites In Multiple Sequence Aligned Files
written by ngsgene
-
Fasta Conversion
written by Syawash •
-
My Pileup File Doesn'T Match The Documented Format? What Are These Columns?
written by Applet •
-
Compairing A 454 Assemblage With A Gene Expression Analysis In Python
written by Nico •
You don't say which fields in your gene prediction file correspond to start and end. And that isn't a Fasta file, my friend. What have you tried so far?
my bad, the file with the orf statistics are is my predicted file and for example the start position for the first orf is 65 and the end is 213. and the fasta file i'm going to search those position is the other one