Thank you, I see.
Ncbi Blast Two Parameters'S Question
Hello, I don't know NCBI BLAST two parameters, here they are:
-num_descriptions <Integer, >=0>
Number of database sequences to show one-line descriptions for
Default = `500'
-num_alignments <Integer, >=0>
Number of database sequences to show alignments for
Default = `250'
I want my every reads to generate only one best hit, I have tried -num_alignments, and is seems it works, but I don't know what's difference between -num_descriptions and -num_alignments? Does anyone know and kindly tell me.
Thanks
• 2,554 views
•
link
1 answer
Descriptions are the one-line summaries of each alignment in the BLAST report. For example:
Score E
Sequences producing significant alignments: (bits) Value
emb|AL139421.12| Human DNA sequence from clone RP4-717I23 on chr... 194 3e-46
The part that begins "emb" and ends "..." is the description.
Alignment is the actual alignment in the BLAST report. For example:
>emb|AL139421.12| Human DNA sequence from clone RP4-717I23 on chromosome 1p21.2-22.3
Contains the 3' end of the NY-SAR-41 gene for sarcoma
antigen NY-SAR-41, a ribosomal protein L39 (RPL39)
pseudogene and the 3' end of a novel gene, complete
sequence
Length = 82367
Score = 194 bits (98), Expect = 3e-46
Identities = 98/98 (100%)
Strand = Plus / Plus
Query: 1 ttttccaattctggggctatatagatgatttcacatcaagagaaccatgcaaagtggaag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50109 ttttccaattctggggctatatagatgatttcacatcaagagaaccatgcaaagtggaag 50168
Query: 61 atttctgctgactctcaaaagtcttctgttcagcaact 98
||||||||||||||||||||||||||||||||||||||
Sbjct: 50169 atttctgctgactctcaaaagtcttctgttcagcaact 50206
Depending on what you intend to do with the BLAST output you may require all, some or none of each, hence the option to set the parameters.
Plenty more documentation at this link.
• 0 views
•
link
• 0 views
•
link
Log in to answer this question.