This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Ncbi Blast Two Parameters'S Question

Hello, I don't know NCBI BLAST two parameters, here they are:

 -num_descriptions <Integer, >=0>
   Number of database sequences to show one-line descriptions for
   Default = `500'
 -num_alignments <Integer, >=0>
   Number of database sequences to show alignments for
   Default = `250'

I want my every reads to generate only one best hit, I have tried -num_alignments, and is seems it works, but I don't know what's difference between -num_descriptions and -num_alignments? Does anyone know and kindly tell me.

Thanks

ncbi blast

1 answer

Descriptions are the one-line summaries of each alignment in the BLAST report. For example:

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|AL139421.12| Human DNA sequence from clone RP4-717I23 on chr...   194   3e-46

The part that begins "emb" and ends "..." is the description.

Alignment is the actual alignment in the BLAST report. For example:

>emb|AL139421.12| Human DNA sequence from clone RP4-717I23 on chromosome 1p21.2-22.3
             Contains the 3' end of the NY-SAR-41 gene for sarcoma
             antigen NY-SAR-41, a ribosomal protein L39 (RPL39)
             pseudogene and the 3' end of a novel gene, complete
             sequence
          Length = 82367

 Score =  194 bits (98), Expect = 3e-46
 Identities = 98/98 (100%)
 Strand = Plus / Plus


Query: 1     ttttccaattctggggctatatagatgatttcacatcaagagaaccatgcaaagtggaag 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50109 ttttccaattctggggctatatagatgatttcacatcaagagaaccatgcaaagtggaag 50168


Query: 61    atttctgctgactctcaaaagtcttctgttcagcaact 98
             ||||||||||||||||||||||||||||||||||||||
Sbjct: 50169 atttctgctgactctcaaaagtcttctgttcagcaact 50206

Depending on what you intend to do with the BLAST output you may require all, some or none of each, hence the option to set the parameters.

Plenty more documentation at this link.

Log in to answer this question.