This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Meme/Ame - bad file error

Hi, running into an issue I never saw on my previous HPC, when running the following command from meme/5.1.1:

ame --verbose 1 --oc cluster3_001_genes_ame --scoring avg --method fisher --evalue-report-threshold .05 --control --shuffle-- gencode.vM18.promoters.filtered.fa JASPAR2018_CORE_vertebrates_redundant_pfms_meme.meme

Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
FATAL: Template does not contain data section.

Not sure if its something about the format of the motif file, shown below, but have never seen this error previously. Thanks.

MEME version 4

ALPHABET= ACGT

strands: + -

Background letter frequencies
A 0.25 C 0.25 G 0.25 T 0.25

MOTIF MA0002.1 RUNX1
letter-probability matrix: alength= 4 w= 11 nsites= 26 E= 0
 0.384615  0.076923  0.115385  0.423077
 0.461538  0.076923  0.038462  0.423077
 0.153846  0.269231  0.038462  0.538462
 0.038462  0.038462  0.000000  0.923077
 0.076923  0.000000  0.884615  0.038462
 0.076923  0.307692  0.000000  0.615385
 0.000000  0.000000  1.000000  0.000000
 0.000000  0.000000  1.000000  0.000000
 0.000000  0.038462  0.000000  0.961538
 0.307692  0.076923  0.000000  0.615385
 0.500000  0.076923  0.153846  0.269231
URL http://jaspar.genereg.net/matrix/MA0002.1
meme ame motif

Actually I figured out that its not the motif file but the fasta file itself. Something about its formatting. Looks like this:

>chr1:9545947-9547947
GCCGTTGGGGCTACAAGCGCGCCCGGGATGACACTAAAGAATGGCTGATCGAGGTGCCTGGGAGCGCCGACCCCATGGAAGACCAGTTCGCCAAGAGGACTCAGGCCAAGAAAGAACGCGTGGCCAAGAATGAGCTGAACCGTCTGCGGAACCTGGCTCG

However when I just try to substitute the genome assembly fasta, with the following format, ame runs fine:

>chr1 1
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Cant quite figure out what the issue is, I removed the coordinates from the fasta to match what the assembly looks like but no dice.

0 answers

No answers yet.

Log in to answer this question.