I just want to know about the tophat temporary file creation. During tophat2 run in the temporary folder the segment.juncs file is created and also segment_juncs.fa file creates. So I just want to know the difference between these 2 files. For example:
seq@seq:~/tophat_out/tmp$ head segment.juncs
1 10505 181036 -
1 12226 12612 +
1 12226 183131 +
1 12979 183498 +
1 13032 183552 +
1 13047 13216 +
1 13047 183735 +
1 13051 13220 +
1 13051 13233 +
1 13051 183571 +
seq@seq:~/tophat_out/tmp$ head segment_juncs.fa
>1|10480|10505-181036|181062|GTAG|rev
AGCCGGCCCGCCCGCCCGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCA
>1|12201|12226-12612|12638|GTAG|fwd
ATCAACTTCTCTCACAACCTAGGCCAGTGTGTGGTGATGCCAGGCATGCCCT
>1|12201|12226-183131|183157|GTAG|fwd
ATCAACTTCTCTCACAACCTAGGCCAGTGTGTGGTGATGCCAGGCATGCCCT
>1|12954|12979-183498|183524|GTAG|fwd
GTCATCCCCTTCACTCCCAGCTCAGAAGCCCAGGCCAGGGGCCCCCAAGAAA
>1|13007|13032-183552|183578|GTAG|fwd
CTCTGGTGGAGAACCTGTGCATGAAGGCTGTCAACCAGTCCATAGGCAAGCC
I want to know which coordinates I take as a linear RNA formation -
>1|10480|10505-181036|181062|GTAG|rev
So I consider 1:10505-181036 OR 10480-181062. Thanks in advance
•
written
by
harry •
1 answer
Not sure what you mean as "linear RNA formation".
The coordinates in the file segment.juncs indicate the positions of putative splice junction. The sequences between those coordinates thus represent putative introns.
Internally, tophat2 take a few nucleotides before the splice junction (that would be 1:10480-10505) and a few nucleotides after the splice junctions (1:181036-181062), paste them together in segment_juncs.fa, and use that sequence (AGCCGGCCCGCCCGCCCGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCA) to map reads that span the splice junction.
Log in to answer this question.