Hi all,

I have PE 80bp data and am running through Scripture.

I have aligned SE using tophat2 and get a SAM, sorted as per the walkthrough on the Broad website:#

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

for x in 1 2; do

tophat2 -o ./s1"$x".tophat.output/ -p 8 -G ~/data/endo/110831/realign/UMD/top2/PEalignment/scripture/aligns/Bostaurus.UMD3.1.66indexed.gtf --solexa1.3-qu als --library-type fr-unstranded --b2-very-sensitive Bostaurus.UMD3.1.66 ~/data/endo/110831/realign/UMD/top2/PEalignment/s1"$x"sequence.fa

samtools view ./s1"$x".tophat.output/acceptedhits.bam ./s1"$x".tophat.output/acceptedhits.sam

sed '1,2d' ./s1"$x".tophat.output/acceptedpicardrmdup.sam | sort > ./s1"$x".tophat.output/scripturehits.sorted.sam

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

But when I try the makePairedFile command I get a very small SAM (~300 lines). My read names grep to the thousands so this is not working on the scripture side. Any ideas about what SAM files should look like? Excerpt below:

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

HWUSI-EAS325L0005FC:1:7:2380:19772#0 272 chr10dna:chromosomechromosome:UMD3.1:10:1:104305016:1 38606 1 80M * 0 0 TCATTGACTCAACAAGTACATACTGCTCAATATGTTGATACTATGTCCAAAAATGTTTCTTTAACATTGGCAACACAAGA * AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:77G2 YT:Z:UU NH:i:3 CC:Z:chr17dna:chromosomechromosome:UMD3.1:17:1:75158596:1 CP:i:69622293 HI:i:0

HWUSI-EAS325L0005FC:1:58:5164:20374#0 272 chr10dna:chromosomechromosome:UMD3.1:10:1:104305016:1 38612 1 80M * 0 0 ACTCAACAAGTACATACTGCTCAATATGTTGATACTATGTCCAAAAATGTTTCTTTAACATTGGCAACACAGGAAGCTAT IIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIHFGIIIIIIIIIIHHIHIHIHIIIIGIIIIIIIIHIGIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:80 YT:Z:UU NH:i:3 CC:Z:chr17dna:chromosomechromosome:UMD3.1:17:1:75158596:1 CP:i:69622299HI:i:0

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Thanks, and sorry I couldnt get italics to work on my code...

Bruce.