I have an issue.
I already have the entire ncbi nt database downloaded which I perform my nulceotide searches on.
I am wishing to add sequences from a .fasta file.
My file format is as follows:
>Allobacillus_halotolerans
GTAATCCGTGAAAGAGAAATCGGCGTTAATTAATTGACAATTGAGAGGAGGTCAACCTCAAATGAGTGAACGCAATAACCGTAAAGTTTACAGTGGTCGTGTTGTTTCTGACAAAGCAGACAAAACAATCACTGTTGTGGTAGAAACGTATAAATTCCATC
I run the command:
$ makeblastdb -in Allobacillus.halotolerans.genome.fasta -dbtype nucl -out allobac_halo-parse_seqids
I get: .nsq, .nsi, .nsd, .nog, .nin, .nhr files out
I compare to the files which exist for the ncbi nt files. Im missing an .nhd, .nhi, .nnd and .nni file. Any idea how to generate those? Contrary, I've produced an .nsd and .nsi file which don't exist for the NCBI nt database. I've looked for information on these formats and there is none. Great.
My main problem is when I try and combine the nt database with my new sequence database with the alias tool
$ blastdb_aliastool -dblist nt allobac_halo -dbtype nucl -title "ntbh" -out ntandbh
I get the following error 'Too many positional arguments (1), the offending value: allobac_halo'. The command is written out and not copied from anywhere, so it can't possibly be a problem with the hyphenation. I've looked at previous answers on the forum which imply my command is correct.
If anyone can share some knowledge, that would be appreciated. Thanking you.
0 answers
No answers yet.
Log in to answer this question.
I've worked out I can generate .nhd and .nhi by using the additional option '-hash_index'. Still need to generate .nnd and .nni.
Also tried
Still failing with error message:
Enclose the database name in quotes. See example below.
May I ask, why you want to append this to nt?