I'm not able to understand what this excerpt means ... Does he say he can modify the genetic code?
As written above, each is a method of the codonw.CononSeq object, e.g.
import codonw
cseq = codonw.CodonSeq("ATGAATATGCTCATTGTCGGTAGAGTTGTTGCTAGTGTTGGGGGAAGCGGACTTCAAACG")
cseq.cai()
The return type can be a simple value, pd.Series, or pd.DataFrame.
The genetic codes can be specified by setting the CodonSeq.genetic_code property with a pd.Series whose index is a codon and value is the single letter amino acid. Instantiate an object and see CodonSeq.genetic_code for more details.
Some indicies have an option of reference values to choose from (e.g. CodonSeq.fop). Several references values can be chosen by specifying the corresponding integer. If you'd like to have user-provided reference values, please implement this functionality and make a pull-request.
1 answer
Just read the source code :) (There is much better information about the cai function.)
Regarding the user-provided reference values, it seems that only E. coli, B. subtilis and S. cerevisiae reference values are implemented in the library, if you need some different organism, you need to add them yourself.
Hope this helps.
Log in to answer this question.