How to use bowtie2, reporting only the chromosomal coordinate
I'm familiar with using bowtie2 to align sequence files to reference. But I want to get a simple report only showing the chromosomal coordinate. Such as chr4 \t 11111111111111 \t 33333333333333
Is there any way to do this?
Beforehand, I tried this command. bowtie2 -x genome_index -c CAACTCCAGTCCCAAATATGTAGCTGTT --very-sensitive
1 answer
Aligners are going to generally output in SAM format. If you just need the chromosome and start position then you can pipe the output to awk and print the fields you need out.
bowtie2 -x genome -c CAACTCCAGTCCCAAATATGTAGCTGTT --very-sensitive | grep -v "^@" | awk -F "\t" '{OFS="\t"}{print $3,$4}'
Log in to answer this question.
More posts like this
-
Error: Encountered internal Bowtie 2 exception (#1)
written by gabriel •
-
bowtie2-align exited with value 139 ?
written by star
-
no exact read?
written by star
-
Aligning Ion torrent sequenced genome with a reference sequence
written by Paul
-
bowtie2-align exited with value 139
written by anu014
-
Bowtie2 alignment error
written by micro32uvas •
-
Bowtie2 error with single end mapping
written by H.Hasani
-
Bowtie Parameter Switch Error
written by datascientist28
-
to run bowtie on multiple fastq file
written by Kritika
-
hello I know I must accept that im a stupid
written by jivarajivaraj •
