I am doing some experiment with BowTie. Now, I want to do experiment with 150 bps read length. So, I download it from here. And converted to fastq format. Now, I see, the fastq format looks like,
@ERR103405.1 M10_151:1:2:12250:1321 length=302 ATTTACTGCCTTGTGTCTCCAGTGCGCTGAAAATACCTTTATCTTGAAATAAGTTAACTAACTCTTGGATACCTTTAATTAATGCTGGGTTACCACCAGAAATTGTAACGTGGTTAAATAAATCGCCACCAATACGTTTTAATTCATCATAGAACAGCTGGATGTGATTATCGCTGTAGCTGGTGTGATTCTGCATTTACTTGGGATGGTAGTGCTAAAGGCGATATAAAACTCATGACCGCTGAAGAAATTTATGATGAATTAAAACGTATTGGTGGCGATTTATTTAACCACGTTACAAT
+ERR103405.1 M10_151:1:2:12250:1321 length=302 CCCFFFFFHHHHHHHIHJJJJJIIJJIJJIJJJIIGJJJJIIGIJJHIGIIJJIIIJIIJJIJEIJIJFIIIFJGHHGHHFFFFFFFEDCCACCDA?ABDDDDDDCDC@?<ABBBDDDDEDDDC<?B?@BDDDDDB>CC@C:>AADDCACDB@CFFFDDHHBFHEHIIIIIGJIHHEGHIIHE1C?D?GGGIIIIGIFI>BHHIJ@3CHBDGGICHGEHIIGHE>BEDEDE;ACCDDCCA?B=BBCDCCCC@@>>C@CDC>@DCDCDDD<<@?AC(2??BDBDBCDCDDCC::?881<?C>:
Now in NCBI, they described it as "DNA for paried end (150bp) sequencing on an illumina MiSeq". But here it looks it is 302 bps read. Can anybody help me why it is given in above sequence, "length=302" while it is written in the page that it is a 150 bps read.
2 answers
If you are converting from SRA to FASTQ using the SRA Toolkit, you need to split joined reads. This option puts forward + reverse reads into one file:
fastq-dump --split-spot myfile.sra
And this one generates 2 separate files for forward + reverse:
fastq-dump --split-files myfile.sra
See my blog post for some more details.
Hi. The link you provided, it clearly says that reads are joined. So you can parse the file and separate the reads till 151 bp each. If you will click on "Metadata" (at link you mentioned), its written that actual_read_length:151.
Another point is, here (http://www.ncbi.nlm.nih.gov/sra/SRX145461) it says 1 forward, 151 reverse. What does it mean ?
read1 and read2 are in paired end
Log in to answer this question.