Issue interpreting plasmidSPAdes output
Hi all,
I am using plasmidSPAdes for plasmid prediction on raw sequencing datas.
I ran the following command:
spades.py -o PlasmidSPades_results -1 R1_raw_reads.fastq -2 R2_raw_reads.fastq --plasmid
The program works fine but I'm having trouble interpreting the output files.
Indeed, on the file named contigs.fasta, I have several contigs with the id: component_X. Here is an example:
>NODE_1_length_43010_cov_119.234319_component_0
GCGCGTCGCCGAGCTTGTCGAGC ...
>NODE_20_length_950_cov_73.572738_component_1
TTGCTCAGCTTGTCGGTGGCTTGCCA ...
>NODE_5_length_11025_cov_340.981549_component_2
TATACGCAAATACGTATTTGCGTGATAC ...
I am assuming that because I have 3 different component IDs, my strain has 3 plasmids? Is that absolutely wrong?
If someone would help me interpreting plasmidSPAdes output, it would be very helpful!
Thank you in advance
Audrey
0 answers
No answers yet.
Log in to answer this question.
It's extremely rare to get "closed" or "complete" molecules with whatever assembler. Just three contigs would be an extremely low number for e.g. a bacterial genome assembly. I don't know what exactly plasmid spades does. However, just looking at the headers, the length of your second contig is only 950 nt. Can plasmids be that small?