Hi, I run RepeatMasker with a test data (just 1Mb), but the software are not always "work". Some times it stops at line 2 (Search Engine: NCBI/RMBLAST)more than 4 hours, I don't know why.
RepeatMasker -species drosophila -pa 2 t.fa
RepeatMasker version open-3.3.0
Search Engine: NCBI/RMBLAST
Is there something wrong with my software?
the command is RepeatMasker -species drosophila -pa 2 xxxx.fa
input like this
>arm2L
TTAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTC TGTCTTATTTTACCGCAAACCCAAAT
platform
linux RepeatMasker version open-3.3.0
when it works and when it does not?
I run it with 6 data. When output 4 data, it begin "stop work" at the 4th data and remain on "Search Engine: NCBI/RMBLAST" for 4 hours. Finally,I stopped the software. (6 data have the same size, and all fly data) I try run the 6 data again, but the software remain on "Search Engine: NCBI/RMBLAST" on the 1st data.I stopped the software.
After 6 hours, the software begin work now, and after repeat 2 data it begin remain on "Search Engine: NCBI/RMBLAST"
What's wrong with it? Or is there something wrong with my linux platform?
0 answers
No answers yet.
Log in to answer this question.
Hi. Can you please mention, what is the difference in command or input or platform, when it works and when it does not?
Thank you, I update the information.
Just to confirm - you have 6 fasta files. With same commands, input and platform, sometimes it is working sometime not. I would suggest try to run these files one by one. It can be a memory issue, can you check how much memory others are using? Otherwise it can also be network problem because it stops at search engine. Did you get output for first 3 files when you ran first time?
Yes,I get output for first 3 files, and when it stops at search engine I use "top" command, there is not a process about RepeatMasker. Everytime, when it stopped I should exit the terminal and relogin. If I don't do that the RepeatMasker will always remain on "Search Engine: NCBI/RMBLAST".