This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Get sequence by genomic coordinates in R

I've realised that after many years of using R, I still don't know a good way to extract a sequence by genomic coordinates. I tried using bioMart, but it seems like getSequence() can't just get any sequence, it asks for some anchors such as gene name, etc. Would appreciate your advice!

r sequence
• 6,576 views • link
updated by trilobiit • trilobiit • written by a11msp a11msp

1 answer

In R given a BSgenome object, here chr1:3000000-3000100, using the Biostrings library:

my.dnastring <- as.character(Biostrings::getSeq(BSgenome.Mmusculus.UCSC.mm10, "chr1", 3000000, 3000100))

my.dnastring
> NTTCTGTTTCTATTTTGTGGTTACTTTGAGGAGAGTTGGAATTAGGTCTTCTTTGAAGGTCTGGTAGAACTCTGCATTAAACCCATCTGGTCCTGGGCTTT
• 0 views • link
written by ATpoint ATpoint

This is great - thanks very much!

• 0 views • link
written by a11msp a11msp

Can I somehow use this with a file that contains genomic coordinates. I have a data.frame and GRange object that contains all the coordinates for my sequences that I would like to retrieve.

• 0 views • link
written by trilobiit • trilobiit

Log in to answer this question.

More posts like this