Specific over-represented sequence FastQC · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Specific over-represented sequence FastQC

Hi guys, Had a quick question RE, an over-represented sequence from human transcriptomic data. I've already trimmed for adapters and aligned to the genome with star - After running a fastQC on one of the BAM files I have a warning about an over represented sequence "GGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGA" Comes up just over 36000 times and after a quick google search I have seen it come up in a few other instances online. After a blast search I found that it shares 100% homology with a few regions, such as, "Homo sapiens RNA component of signal recognition particle 7SL2 (RN7SL2), small cytoplasmic RNA"

Anyone know what might be happening and if it is going to be a problem going forward?

Thanks in advance!

rna-seq fastqc

• 1,097 views • link

written 6.0 years ago by harrydolan.dc •

Since it only shows up 36000 times, out of I'm assuming 30 million+ reads, I wouldn't worry about it yet. Go on to alignment and see how it looks.

• 0 views • link

written 6.0 years ago by rpolicastro

0 answers

No answers yet.

Log in to answer this question.

More posts like this

Tool: Quickly Build Your Own GEOmetadb with geokit
written 7 months ago by Yun •

If you are conducting bioinformatics research, especially when dealing with GEO (Gene Expression Omnibus) data, you may have used the [GEOmetadb](https://github.com/zhujack/GEOmetadb) package. While it was …
Removing overrepresented sequences in paired end RNA-seq
written 3.1 years ago by LayneSadler

After trimming and QC'ing RNAseq for adapters with `trim_galore` (`cutadapt`+`fastqc`), should I remove over-represented sequences that FastQC identifies as **possible adapter/primer source**? [Is there a …
How to get gene lengths ?
written 4.5 years ago by AlexStar •

I have a raw RNA expression data frame with genes as rows (HUGO gene names) and samples as columns (homo sapiens research). I want to …
Finding all possible alignments of two sequences
written 8.4 years ago by prishly •

Hi, Are there implementations of dna sequence alignment or motif search algorithms (or extensions of existing algorithms) that **find not one but all possible alignments …
Choosing the right RNA-seq experiment: polyA mRNA vs polyA depleted
written 9.3 years ago by fabrizio.frasca •

Hello (: I am relatively new to bioinformatics and I am a Computer Scientist, not a biologist so, I apologize in advance if the question …
Weird Kmer at 5' of read 1 in paired-end RNA-seq
written 9.3 years ago by izzy.yichao.cai

Hi all, I've come across a weird issue with my RNA-seq data. Some details about the data: There 4 libraries of RNA, all total RNA-seq …
Problems to find over-represented TFBS with TOUCAN software
written 9.5 years ago by CiAlves •

Hi, please, can anybody help me? Recently I downloaded the TOUCAN software last version to identify transcription factor-binding sites in different haplotypes (sequences) originated from …
ERCC spike in
written 9.8 years ago by GLFR •

Hello! I apologise if I am asking a basic question but I was wondering if someone here could clue me in about the role of …
Trimming paired end RNA-seq with Trimmomatic
written 12.1 years ago by samantha_jeschonek

Hello -- I've begun pre-processing of my paired-end RNA seq data (run on Illumina HiSeq). After running fastqc on my samples, I noticed some have …
Convert List With Several Different Gene Identifiers Using Command Line/Programmatically
written 12.9 years ago by stenemo88 •

<p>The question at hand is how to most effectively take a query list (of over 100 entries) containing multiple different gene and/or protein identifiers and …